Vectors




ORFeome Vectors and Flanking Sequences

Most of the Entry Clones distributed by the ORFeome Collaboration (OC) have been generated by cloning a PCR product of the protein-coding sequence (CDS) of a cDNA, using PCR primers that include 22-25 nt attB1 and attB2 sites. This attB-PCR product is a substrate for BP site-specific recombinational cloning in the Gateway cloning system, by which it can be used to produce an Entry Clone of the PCR product.

For example, an OC Entry clone containing a CDS for the gene ACTB was generated by BP recombination between an attB-PCR product (attB1-ACTB-attB2) and a pDONR plasmid (pDONR221), to give the OC Entry Clone (pENTR221-ACTB), accession DQ890960.

Different groups within the OC have contributed OC clones, and each group uses its own preferred pDONR plasmid and sequences flanking the CDS. Table I, below, lists the types of Donor Vectors used to generate OC Entry Clones, as well as the att sites and adjacent sequences that flank the CDS of Entry clones contributed by each group.

Note that cloning of an attB-PCR product into a pDONR vector transforms this vector into a pENTR vector. In most cases, however, the listed Entry vectors (i.e., without a cDNA insert or with a multiple cloning site in place of the insert) are not commercially available. Exceptions are pENTR/D-TOPO and pENTR223.1, where both the Entry Vectors are potentially available for use in generating other Entry clones.

Both BP cloning, using pDONR223.1, and restriction enzyme + DNA ligase cloning, using pENTR223.1-Sfi, were used to generate several thousand MGC clones with synthetic DNA inserts, as described at: http://mgc.nci.nih.gov/Vectors/prot_pENTR223. An example of a synthetic cDNA clones in pENTR223.1 is BC148359, a synthetic clone for MAP4K1.

Although the choices of Gateway vectors and flanking sequences vary between the groups contributing clones to the OC, all the OC clones are designed to maintain the correct phase of the reading frame, thus enabling the production of N-fusion or C-fusion proteins, when recombined via LR recombination into the appropriate Destination Vectors, to yield the respective Expression clone.

Because the flanking att sequences in OC clones may vary from those listed in Table I, it is imperative to verify in the GenBank record which sequences were used for each particular clone.

The BP cloning reaction for RT-PCR products is: attB (PCR product) x attP (pDONR plasmid) attL (Entry Clone) + attR by-product. The product of this attB x attP recombination is an Entry Clone, a cDNA insert flanked by attL sites. The LR reaction is: attL (Entry Clone) x attR (Destination Vector) attB (Expression Clone) + attP by-product. For additional details on the Gateway reactions, see: Cheo et al. 2004. Genome Res. 14:2111-2120; and http://www.invitrogen.com/site/us/en/home.html

pENTR/D-TOPO can be ordered from Invitrogen Corp. pENTR223.1-Sfi and pDONR223.1 are proprietary Invitrogen vectors.



  1. pENTR/D-TOPO
  2. pENTR201
  3. pENTR221
  4. pENTR223
  5. pENTR223.1
  6. pENTR223.1-LC


Note: The sequencing primers listed below for each vector are not exhaustive (only the most commonly used primers have been checked, -21M13, M13 reverse, t7, t3, and sp6) and others not listed may also be suitable. We also recommend that you check the exact sequence of your primer against the vector sequence to ensure that it matches, as there are often several slightly different versions of these common primers. When custom primers are required, their sequences are listed.

pENTR/D-TOPO

NAME: pENTR/D-TOPO (kanamycin resistant; 25 ug/ml)
SOURCE: Invitrogen Corp.
V_TYPE: Gateway entry vector
POLYLINKER SEQUENCE:
TAACGCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCC
AGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGAC
CTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTT
TGTACAAAAAAGCAGGCTCCGCGGCCGCCCCCTTCACC-ORF-AAGGGTG
GGCGCGCCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGAAAGCAT
TGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAAT
CATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGG
TCATAGCTGTTTCCTGGCAGCTCTG
FULL SEQUENCE: Available here
VECTOR MAP:
SEQUENCING PRIMERS: M13(-21), t7, M13 reverse
||


pENTR201

NAME: pENTR201 (kanamycin resistant; 10ug/ml)
SOURCE: derived from pDONR201, available from Invitrogen Corp.
V_TYPE: Gateway entry vector
POLYLINKER SEQUENCE:
ACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACC
GCTAGCCAGGAAGAGTTTGTAGAAACGCAAAAAGGCCATCCGTCAGGATG
GCCTTCTGCTTAGTTTGATGCCTGGCAGTTTATGGCGGGCGTCCTGCCCG
CCACCCTCCGGGCCGTTGCTTCACAACGTTCAAATCCGCTCCCGGCGGAT
TTGTCCTACTCAGGAGAGCGTTCACCGACAAACAACAGATAAAACGAAAG
GCCCAGTCTTCCGACTGAGCCTTTCGTTTTATTTGATGCCTGGCAGTTCC
CTACTCTCGCGTTAACGCTAGCATGGATCTCGGGCCCCAAATAATGATTT
TATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGC
TTTTTTATAATGCCAACTTTGTACAAAAAAGCTGGCACCATG-linker-
ORF-linker-GGCGACCCAGCTTTCTTGTACAAAGTTGGCATTATAAGA
AAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAA
TAAAATCATTATTTGCCATCCAGCTGCAGCTCTGGCCCGTGTCTCAAAAT
CTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAA
ACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTC
AACGGGAAACGTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTA
TATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAAT
CTATCGCTTGTATGGGAAGCCCGATGCGC
FULL SEQUENCE: Available here
VECTOR MAP:
SEQUENCING PRIMERS: pDONR201-reverse [GTAACATCAGAGATTTTGAGACAC], pDONR201-forward [TCGCGTTAACGCTAGCATGGATCTC]
||


pENTR221

NAME: pENTR221 (kanamycin resistant; 10ug/ml)
SOURCE: derived from pDONR221, available from Invitrogen Corp.
V_TYPE: Gateway entry vector
POLYLINKER SEQUENCE:
CGACAAACAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTC
GTTTTATTTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATG
GATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCG
GGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAA
CAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGC
AGGCT-linker-ORF-linker-ACCCAGCTTTCTTGTACAAAGTTGGC
ATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTAT
CAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTG
AGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCT
CAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAAC
AATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCC
ATATTCAACGGGAAACGTCGAGGCCGCGATTAAATTCCA
FULL SEQUENCE: Available here
VECTOR MAP:
SEQUENCING PRIMERS: M13(-21), M13 reverse
||


pENTR223

NAME: pENTR223 (spectinomycin resistant; 100 ug/ml)
SOURCE: Protein Expression Laboratory, NCI-Frederick
V_TYPE: Gateway entry vector
POLYLINKER SEQUENCE:
CAACAGATAAAACGAAAGGCCCAGTCTTCCGACTGAGCCTTTCGTTTTAT
TTGATGCCTGGCAGTTCCCTACTCTCGCGTTAACGCTAGCATGGATGTTT
TCCCAGTCACGACGTTGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCA
AATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTG
ATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTG-link
er-ORF-linker-CCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAG
CATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAA
AATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACA
TGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAATCTCTGA
TGTTACATTGCACAAGATAAAAATATATCATCATGCCTCCTCTAGACCAG
CCAGGACAGAAATGCCTCGACTTCGCTGC
FULL SEQUENCE: Available here
VECTOR MAP:
SEQUENCING PRIMERS: M13(-21), t7
||


pENTR223.1

NAME: pENTR223.1 (spectinomycin resistant; 100 ug/ml)
SOURCE: Invitrogen Corp.
V_TYPE: Gateway entry vector
POLYLINKER SEQUENCE:
GCTAGCATGGATGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCAGTC
TTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGT
TCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTA
CAAAAAAGCAGAAG-linker-ORF-linker-GCCCAGCTTTCTTGTAC
AAAGTTGGCATTATAAAAAATAATTGCTCATCAATTTGTTGCAACGAACA
GGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCC
CCTATAGTGAGTCGTATTACATGGTCAT
FULL SEQUENCE: Available here
VECTOR MAP:
SEQUENCING PRIMERS: M13(-21), t7
||


pENTR223.1-LC

NAME: pENTR223.1-LC (spectinomycin resistant; 100 ug/ml)
SOURCE: Blue Heron, Inc.
V_TYPE: Gateway entry vector with pBR ori
POLYLINKER SEQUENCE:
GTACAAAAAAGCAGAAG- ggccgtcaaggcccacc(linker)-ORF-
ggcctcatgg(linker)-GCCCAGCTTTCTTGTAC
FULL SEQUENCE: Available here
SEQUENCING PRIMERS: M13F, M13 reverse
||


Table I. Summary of Vectors and Flanking Sequences in ORFeome Clones (10/1/08)
(Sequences read from 5' (from the promoter) to 3' as they would appear in the vector)
Clone
Source
Donor
Vector
Entry
Vector
(type att site)
5' End of attL1.x + Seq to ATG 3' End of ORF to attL2.x
MGC
Synthetic
pDONR223.1 pENTR223.1
(att1-att2)
SpnR
-G TAC AAA AAA GCA GAA GGG CCG TCA AGG CCC ACC ATG
Y K K A E G P S R P T
-NNN-TAA/G GGC CTC ATG GGC CCA GCT TTC TTG TAC
* G L M G P A F L Y
MGC
Synthetic
pDONR223.1 pENTR223.1
(att1-att2)
SpnR
-G TAC AAA AAA GCA GAA GGG CCG TCA AGG CCC ACC ATG
Y K K A E G P S R P T
-NNN-TCA GGC CTC ATG GGC CCA GCT TTC TTG TAC
S G L M G P A F L Y
WTSI pDONR223 pENTR223
(att1.1-att2.1)
SpnR
-G TAC AAA AAA GTT GGC ACC ATG
Y K K V G T
-NNN-CCA ACT TTC TTG TAC-
P T F L Y
DFCI-
CCSB

(ORFeome 1&3)
pDONR223 pENTR223
(att1.1-att2.1)
SpnR
-G TAC AAA AAA GTT GGC ATG
Y K K V G
-TA/GC CCA ACT TTC TTG TAC- TRC replaces stop
P T F L Y
DFCI-
CCSB

(ORFeome 5&7)
pDONR223 pENTR223
(att1.1-att2.1)
SpnR
-G TAC AAA AAA GTT GGC ACC ATG
Y K K V G T
-NNN-TTG CCA ACT TTC TTG TAC- TTG replaces stop
L P T F L Y
HIP pDONR221 pENTR221
(att1-att2)
KnR
-G TAC AAA AAA GCA GGC TCC ACC ATG
Y K K A G S T
-TAG-GAC CCA GCT TTC TTG TAC
* D P A F L Y
HIP pDONR221 pENTR221
(att1-att2)
KnR
-G TAC AAA AAA GCA GGC TCC ACC ATG
Y K K A G S T
-TTG-GAC CCA GCT TTC TTG TAC
L D P A F L Y
Kazusa pDONR201 pENTR201
(att1-att2)
KnR
-G TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG
Y K K A G F E G D R T
-TAA GTA GAC CCA GCT TTC TTG TAC
* V D P A F L Y
Kazusa pDONR201 pENTR201
(att1-att2)
KnR
-G TAC AAA AAA GCA GGC TTC GAA GGA GAT AGA ACC ATG
Y K K A G F E G D R T
-TAC GTA GAC CCA GCT TTC TTG TAC
Y V D P A F L Y
DKFZ pDONR221 pENTR221
(KnR)
-G TAC AAA AAA GCA GGC TCC ACC ATG-
Y K K A G S T
-TGA ATC CAC CCA GCT TTC TTG TAC-
* I H P A F L Y
DKFZ pDONR221 pENTR221
(KnR)
-G TAC AAA AAA GCA GGC TCC ACC ATG-
Y K K A G S T
-TGG ATC CAC CCA GCT TTC TTG TAC-
W I H P A F L Y
DKFZ pDONR221 pENTR221
(KnR)
-G TAC AAA AAA GCA GGC TCC ACC ATG-
Y K K A G S T
-AAG CTT GAC CCA GCT TTC TTG TAC-
K L D P A F L Y
DKFZ pDONR221 pENTR221
(KnR)
-G TAC AAA AAA GCA GGC TCC ACC ATG-
Y K K A G S T
-TGT ATT CAC CCA GCT TTC TTG TAC-
C I H P A F L Y
DKFZ pDONR221 pENTR221
(KnR)
-G TAC AAA AAA GCT GGC ACC ATG-
Y K K A G T
-GGC GAC CCA GCT TTC TTG TAC-
G D P A F L Y
DKFZ pDONR221 pENTR221
(KnR)
-G TAC AAA AAA GCA GGC TCC ACC ATG-
Y K K A G S T
-TAG CTT GAC CCA GCT TTC TTG TAC-
* L D P A F L Y
DKFZ pDONR221 pENTR221
(KnR)
-G TAC AAA AAA GCA GGC TCC ACC ATG-
Y K K A G S T
-TGA ATT CAC CCA GCT TTC TTG TAC-
* I P P A F L Y
DKFZ pDONR201 pENTR201
(KnR)
-G TAC AAA AAA GCT GGC ACC ATG-
Y K K A G T
-GGC GAC CCA GCT TTC TTG TAC-
G D P A F L Y
DKFZ pDONR201 pENTR201
(KnR)
-G TAC AAA AAA GCT GGC ACC ACC ATG-
Y K K A G T
-TAG GGC GAC CCA GCT TTC TTG TAC-
* G D P A F L Y
DKFZ None pENTR/D-
TOPO*
(KnR)
-G TAC AAA AAA GCA GGC TCC GCG GCC GCC CCC TTC ACC ATG-
Y K K A G S A A A P F T
-AGG GGT GGG CGC GCC GAC CCA GCT TTC TTG TAC-
K G G R A D P A F L Y

These vectors can be ordered from Invitrogen Corp.

Key to abbreviations: MGC: NIH Mammalian Gene Collection; WTSI: Wellcome Trust Sanger Institute;
HIP: Harvard Institute of Proteomics; DFCI-CCSB: Dana-Farber Cancer Institute, Center for Cancer Systems Biology;
Kazusa: Kazusa DNA Research Institute; DKFZ: German Cancer Research Center

* Stop codon (suppression potentially can yield C-terminal fusion proteins)