Human Full ORF Libraries

Vector information

Library information

Synthetic

1. Blue Heron synthetic (pENTR223.1-LC)
2. NIH_MGC_369
3. NIH_MGC_370
4. NIH_MGC_371
5. NIH_MGC_372
6. NIH_MGC_425
7. NIH_MGC_428
8. NIH_MGC_435
9. NIH_MGC_489

Standard (non-synthetic)

10. CCSB-DFCI hORFeome collection
11. DFCI-Kazusa.orf
12. DFCI-RIKEN.orf
13. DKFZo001
14. DKFZo002
15. DKFZo003
16. DKFZo004
17. DKFZo005
18. DKFZo006
19. DKFZo007
20. DKFZo008
21. DKFZo009
22. DKFZo010
23. DKFZo011
24. DKFZo012
25. HIP_Gateway201_closed
26. HIP_Gateway201_fusion
27. HIP_Gateway221_closed
28. HIP_Gateway221_fusion
29. WTSI-chORF
30. WTSI-ohORF


Blue Heron synthetic (pENTR223.1-LC)

NAME: Blue Heron synthetic (pENTR223.1-LC)
LIB_ID: 2557
ORGANISM: human
ORGAN: synthesized DNA
HOST: DH10B TonA
VECTOR: pENTR223.1-LC
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
This clone is a part of a collection of full-length cDNA clones generated by Mammalian Gene Collection project. DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1-LC. Details for pENTR223.1-LC are described here. Clone structure of the ORF and flanking sequences is as follows: 5'- gtacaaaaaagcagaagggccgtcaaggcccacc -open reading frame- TAGggcctcatgggcccagctttcttgtac -3'. This clone is also a part of the ORFeome Collaboration clones. Contact MGC help desk by email. Tissue Procurement, cDNA Library Preparation and DNA Sequencing by Blue Heron Biotechnology, Inc.. cDNA Library Arrayed by The I.M.A.G.E. Consortium. MGC clone distribution information can be found through the I.M.A.G.E. Consortium.
||

NIH_MGC_369

NAME: NIH_MGC_369
LIB_ID: 2362
ORGANISM: human
ORGAN: synthesized DNA
HOST: DH10B TonA
VECTOR: pENTR223.1
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
This library is a part of a collection of full-length cDNA clones generated by Mammalian Gene Collection project. DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1). Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-GGCCTCATGGgcccagctttcttg-3'. Clones were synthesized by Codon Devices Inc (Cambridge, MA). Note: this is a Mammalian Gene Collection library.
||

NIH_MGC_370

NAME: NIH_MGC_370
LIB_ID: 2363
ORGANISM: human
ORGAN: synthesized DNA
HOST: DH10B TonA
VECTOR: pENTR223.1
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
This library is a part of a collection of full-length cDNA clones generated by Mammalian Gene Collection project. DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1). Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-GGCCTCATGGgcccagctttcttg-3'. Clones were synthesized by Genscript Corp (Piscataway, NJ). Note: this is a Mammalian Gene Collection library.
||

NIH_MGC_371

NAME: NIH_MGC_371
LIB_ID: 2364
ORGANISM: human
ORGAN: synthesized DNA
HOST: DH10B TonA
VECTOR: pENTR223.1
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
This library is a part of a collection of full-length cDNA clones generated by Mammalian Gene Collection project. DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1). Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-GGCCTCATGGgcccagctttcttg-3'. Clones were synthesized by Picoscript Ltd, LLP (Houston, TX). Note: this is a Mammalian Gene Collection library.
||

NIH_MGC_372

NAME: NIH_MGC_372
LIB_ID: 2365
ORGANISM: human
ORGAN: synthesized DNA
HOST: EC100 T1-resistant
VECTOR: pENTR223.1
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
This library is a part of a collection of full-length cDNA clones generated by Mammalian Gene Collection project. DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1). Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-GGCCTCATGGgcccagctttcttg-3'. Clones were synthesized by Blue Heron Biotechnology Inc (Bothell, WA). Note: this is a Mammalian Gene Collection library.
||

NIH_MGC_425

NAME: NIH_MGC_425
LIB_ID: 2481
ORGANISM: human
ORGAN: synthesized DNA
HOST: DH10B TonA
VECTOR: pENTR223.1
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1). Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TCAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Clones were synthesized by GENEART AG (Regensburg, Germany). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.
||

NIH_MGC_428

NAME: NIH_MGC_428
LIB_ID: 2484
ORGANISM: human
ORGAN: synthesized DNA
HOST: DH10B TonA
VECTOR: pENTR223.1
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1). Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TAAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Clones were synthesized by GENEART AG (Regensburg, Germany). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.
||

NIH_MGC_435

NAME: NIH_MGC_435
LIB_ID: 2491
ORGANISM: human
ORGAN: synthesized DNA
HOST: DH10B TonA
VECTOR: pENTR223.1
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1). Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TAAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Clones were synthesized by Codon Devices (Cambridge, MA). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.
||

NIH_MGC_489

NAME: NIH_MGC_489
LIB_ID: 2555
ORGANISM: human
ORGAN: synthesized DNA
HOST: DH10B TonA
VECTOR: pENTR223.1
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
This library is a part of a collection of full-length cDNA clones generated by Mammalian Gene Collection project. DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in http://mgc.nci.nih.gov/Vectors/prot_pENTR223.1). Clones were synthesized by Blue Heron Biotechnology Inc (Bothell, WA). Note: this is a Mammalian Gene Collection library.
||

CCSB-DFCI hORFeome collection

NAME: CCSB-DFCI hORFeome collection
LIB_ID: 2538
ORGANISM: human
ORGAN: mixed
HOST: DH10B TonA
VECTOR: pDONR223
V_TYPE: plasmid
RE_5': attB1.1
RE_3': attB2.1
STOP_CODON_STATUS: without
DESCR:
Full open reading frame clones were created in the Gateway system by the Center for Cancer Systems Biology (CCSB) at DFCI, M. Vidal director, (reference Genome Res. 200 4 Oct;14(10B):2128-35 and Genomics 2007 Mar;89(3):307-15) using MGC clones as templates. For PCR amplification, both forward and reverse ORF-specific primers for each MGC clone wer e designed automatically using the OSP program (Hillier and Green 1991). The forward primer starts from A of the ATG initiation codon, whereas the reverse primer starts from the se cond nucleotide of the termination codon. The reverse attB2.1 primers do not contain the last nucleotide of the termination codon, so as to allow generation of C-terminal fusion pr oteins. This library is specifically made of single colonies isolated from the transformed ORF pools. Clones were prepared by the M. Vidal laboratory (Dana Farber Cancer Institute) and generously donated for use by the ORFeome Collaboration.
||

DFCI-Kazusa.orf

NAME: DFCI-Kazusa.orf
LIB_ID: 2463
ORGANISM: human
ORGAN: unspecified
HOST: DH5alpha T1-resistant
VECTOR: pDONR223
V_TYPE: plasmid
RE_5': attL1.1
RE_3': attL2.1
STOP_CODON_STATUS: without
DESCR:
Clones from the Kazusa DNA Research Institute were generously donated for use as the starting template. 8 ul of each clone was inoculated in 1 ml LB containing the appropriate antibiotic. A BP recombinational reaction contains 2 ul of 5 X BP3 buffer; 2 ul of BP clonase; 1 ul of pDONR223 (150 ng/uL); 2 ul of PCR product (2-200 ng/uL); 3 uL H2O. The 5 X BP3 buffer consists of 100 mM Tris-Cl (pH 7.5); 20 mM EDTA; 30 mM spermidine-HCL; 25 percent glycerol; 225 mM NaCl. LR reactions we performed as described previously with minor changes (Reboul et al. 2003, Rual et al. 2004). BP products were transformed into liquid cultures of E. coli, with antibiotic selection of spectinomycin at 50 ug/mL. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGCACC-ORF-TTGccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Dana Farber Cancer Institute, Center for Cancer Systems Biology for the ORFeome Collaboration .
||

DFCI-RIKEN.orf

NAME: DFCI-RIKEN.orf
LIB_ID: 2464
ORGANISM: human
ORGAN: unspecified
HOST: DH5alpha T1-resistant
VECTOR: pDONR223
V_TYPE: plasmid
RE_5': attL1.1
RE_3': attL2.1
STOP_CODON_STATUS: without
DESCR:
Clones from the Genomic Sciences Center at RIKEN Yokohama Institute were generously donated for use as the starting template. 8 ul of each clone was inoculated in 1 ml LB containing the appropriate antibiotic. A BP recombinational reaction contains 2 ul of 5 X BP3 buffer; 2 ul of BP clonase; 1 ul of pDONR223 (150 ng/uL); 2 ul of PCR product (2-200 ng/uL); 3 uL H2O. The 5 X BP3 buffer consists of 100 mM Tris-Cl (pH 7.5); 20 mM EDTA; 30 mM spermidine-HCL; 25 percent glycerol; 225 mM NaCl. LR reactions we performed as described previously with minor changes (Reboul et al. 2003, Rual et al. 2004). BP products were transformed into liquid cultures of E. coli, with antibiotic selection of spectinomycin at 50 ug/mL. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGCACC-ORF-TTGccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Dana Farber Cancer Institute, Center for Cancer Systems Biology for the ORFeome Collaboration .
||

DKFZo001

NAME: DKFZo001
LIB_ID: 2460
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR201
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagctggcaCC-ORF-GGCGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo002

NAME: DKFZo002
LIB_ID: 2461
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR201
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagctggcaCC-ORF-GGCGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo003

NAME: DKFZo003
LIB_ID: 2452
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-AAGCTTGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo004

NAME: DKFZo004
LIB_ID: 2453
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGGATCCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo005

NAME: DKFZo005
LIB_ID: 2454
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGTATTCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo006

NAME: DKFZo006
LIB_ID: 2462
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagctggcaCC-ORF-GGCGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo007

NAME: DKFZo007
LIB_ID: 2455
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TAGCTTGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo008

NAME: DKFZo008
LIB_ID: 2456
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGAATCCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo009

NAME: DKFZo009
LIB_ID: 2457
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGAATTCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo010

NAME: DKFZo010
LIB_ID: 2458
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR/D-TOPO
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCGCGGCCGCCCCCTTCACC-ORF-AAGGGTGGGCGCGCCGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo011

NAME: DKFZo011
LIB_ID: 2528
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGAATCCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

DKFZo012

NAME: DKFZo012
LIB_ID: 2529
ORGANISM: human
ORGAN: unspecified
HOST: DH10B TonA
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGAATCCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration .
||

HIP_Gateway201_closed

NAME: HIP_Gateway201_closed
LIB_ID: 2495
ORGANISM: human
ORGAN: unspecified
HOST: DH5alpha T1-resistant
VECTOR: pENTR201
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
||

HIP_Gateway201_fusion

NAME: HIP_Gateway201_fusion
LIB_ID: 2494
ORGANISM: human
ORGAN: unspecified
HOST: DH5alpha T1-resistant
VECTOR: pENTR201
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
||

HIP_Gateway221_closed

NAME: HIP_Gateway221_closed
LIB_ID: 2497
ORGANISM: human
ORGAN: unspecified
HOST: DH5alpha T1-resistant
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: with
DESCR:
||

HIP_Gateway221_fusion

NAME: HIP_Gateway221_fusion
LIB_ID: 2496
ORGANISM: human
ORGAN: unspecified
HOST: DH5alpha T1-resistant
VECTOR: pENTR221
V_TYPE: Gateway entry vector
RE_5': attL1
RE_3': attL2
STOP_CODON_STATUS: without
DESCR:
||

WTSI-chORF

NAME: WTSI-chORF
LIB_ID: 2422
ORGANISM: human
ORGAN: unspecified
HOST: Mach1 T1-resistant
VECTOR: pENTR223
V_TYPE: Gateway entry vector
RE_5': attL1.1
RE_3': attL2.1
STOP_CODON_STATUS: with
DESCR:
ORFs flanked by att sites were amplified from fully sequence verified cDNA clones in two rounds of PCR. Amplified products were separated by agarose gel electrophoresis, excised, purified and recombined into pDONR223 using BP clonase TM. After full sequence verification, only clones which exactly matched the original cDNA and att sequences were accepted. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGCACC-ORF-ccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed by the Wellcome Trust Sanger Institute for the ORFeome Collaboration .
||

WTSI-ohORF

NAME: WTSI-ohORF
LIB_ID: 2423
ORGANISM: human
ORGAN: unspecified
HOST: Mach1 T1-resistant
VECTOR: pENTR223
V_TYPE: Gateway entry vector
RE_5': attL1.1
RE_3': attL2.1
STOP_CODON_STATUS: without
DESCR:
ORFs flanked by att sites were amplified from fully sequence verified cDNA clones in two rounds of PCR. Amplified products were separated by agarose gel electrophoresis, excised, purified and recombined into pDONR223 using BP clonase TM. After full sequence verification, only clones which exactly matched the original cDNA and att sequences were accepted. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGCACC-ORF-ccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Wellcome Trust Sanger Institute for the ORFeome Collaboration .
||