zebrafish (Danio rerio) cDNA Library Information

  Boolean search type:

Instructions: Enter search term(s) and/or number range(s) to search in ORFeome Collaboration Collections: OCAA, OCAB, hORFeome V8.1 (species: human).   Detailed Instructions...

Information for 78 libraries (by tissue)


   1. NIH_ZGC_4
   2. NIH_ZGC_47
   3. zebrafish adult brain
   4. Zebrafish neuronal


   5. NIH_ZGC_34


   6. Appel/Eisen 15-19 hr embryo
   7. Ekker embryo - early gastrulation
   8. Ekker embryo - post-segmentation
   9. Ekker maternal
   10. GISZF001
   11. GISZF001_ha
   12. GISZF001_ma
   13. GISZF001_ra
   14. NCI_CGAP_ZEmb2
   15. NCI_CGAP_ZEmb3
   16. NIH_ZGC_15
   17. NIH_ZGC_18
   18. NIH_ZGC_32
   19. NIH_ZGC_46
   20. RZPD 609
   21. Zebrafish C32 14 somite embryo
   22. Zebrafish SJD 15 day embryo
   23. Zebrafish SJD 2 day embryo
   24. Zebrafish SJD 5 day embryo
   25. Zebrafish SJD day 3 embryo


   26. NIH_ZGC_9
   27. Zebrafish adult retina


   28. NIH_ZGC_30
   29. NIH_ZGC_31
   30. SJD adult pectoral fin
   31. Zebrafish C32 fin
   32. Zebrafish fin day 1 regeneration
   33. Zebrafish fin day 3 regeneration
   34. Zebrafish SJD day 8 fin regeneration


   35. NIH_ZGC_22


   36. NIH_ZGC_16
   37. NIH_ZGC_45


   38. NIH_ZGC_17
   39. Stainier zebrafish heart


   40. NCI_CGAP_ZKid1
   41. Zebrafish gridded kidney


   42. NIH_ZGC_25
   43. NIH_ZGC_8


   44. MPZFRiken1
   45. NIH_ZGC_37
   46. NIH_ZGC_38
   47. NIH_ZGC_39
   48. NIH_ZGC_40
   49. NIH_ZGC_41
   50. NIH_ZGC_42
   51. NIH_ZGC_43
   52. NIH_ZGC_44

olfactory epithelium

   53. NIH_ZGC_14
   54. zebrafish adult olfactory


   55. Campbell zebrafish ovary
   56. Gong zebrafish ovary
   57. NIH_ZGC_26
   58. NIH_ZGC_35
   59. NIH_ZGC_49
   60. NIH_ZGC_5


   61. NIH_ZGC_21


   62. Gong zebrafish testis
   63. NIH_ZGC_23
   64. NIH_ZGC_6


   65. NIH_ZGC_20


   66. NIH_ZGC_36
   67. NIH_ZGC_50

whole body

   68. NIH_ZGC_10
   69. NIH_ZGC_19
   70. NIH_ZGC_27
   71. NIH_ZGC_28
   72. NIH_ZGC_29
   73. NIH_ZGC_48
   74. NIH_ZGC_7
   75. Sugano SJD adult male
   76. Sugano-Kawakami DRA
   77. Zebrafish SJD adult male
   78. Zebrafish SJD adult male II


Name: NIH_ZGC_4
Library ID: 2054
Organism: Danio rerio
Strain: AB
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: brain
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers Recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Reference for library construction: Gene 200, 149-156, 1997. Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_47
Library ID: 2534
Organism: Danio rerio
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: brain
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without

zebrafish adult brain

Name: zebrafish adult brain
Library ID: 1754
Organism: Danio rerio
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: pooled brain
Host: GeneHogs DH10B
Vector: pZL-1
Vector type: plasmid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Directionally cloned. Tissue source: brain tissue from pooled adults of both sexes. Library constructed by J. Ngai.

Zebrafish neuronal

Name: Zebrafish neuronal
Library ID: 1752
Organism: Danio rerio
Age: 0
Organ: brain/CNS
Tissue: GFP-positive neuronal tissue
Host: GeneHogs DH10B
Vector: pBluescript (modified)
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: Library is cloned directionally between the DraIII(X) and DraIII(Y) sites and has been amplified. Library constructed by S. Lin.


Name: NIH_ZGC_34
Library ID: 2420
Organism: Danio rerio
Strain: AB
Gender: neither
Age: 0
Organ: egg
Tissue: activated eggs, 10-15 min, pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.7 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

Appel/Eisen 15-19 hr embryo

Name: Appel/Eisen 15-19 hr embryo
Library ID: 460
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Host: XL-1 Blue
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer. Library was constructed in a ZAP phage vector (Stratagene) using 5' and 3' linker adaptors. Average insert size 1.7 kb. Library constructed by Dr. Bruce Appel and Dr. Judith Eisen (University of Oregon).

Ekker embryo - early gastrulation

Name: Ekker embryo - early gastrulation
Library ID: 453
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Tissue: shield stage (45-55% epiboly)
Vector: pAD-GAL4
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer. Library was constructed in the Hybri-ZAP vector (Stratagene) using 5' and 3' linker adaptors. Average insert size 1.7 kb. This library was constructed bymembers of the laboratories of Dr. P. Hackett, Dr. M. Halpern, and Dr. S. Ekker.

Ekker embryo - post-segmentation

Name: Ekker embryo - post-segmentation
Library ID: 454
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Tissue: completion of eye pigment but lacking body pigmentation
Vector: pAD-GAL4
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer. Library was constructed in the Hybri-ZAP vector (Stratagene) using 5' and 3' linker adaptors. Average insert size 1.5 kb. This library was constructed bymembers of the laboratories of Dr. P. Hackett, Dr. M. Halpern, and Dr. S. Ekker.

Ekker maternal

Name: Ekker maternal
Library ID: 452
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Tissue: mixed oocytes amd embryos
Vector: pAD-GAL4
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer. Library was constructed in the Hybri-ZAP vector (Stratagene) using 5' and 3' linker adaptors. Average insert size 1.2 kb. This library was constructed by members of the laboratories of Dr. P. Hackett, Dr. M. Halpern, and Dr. S. Ekker.


Name: GISZF001
Library ID: 2089
Organism: Danio rerio
Strain: wild type, Singapore strain
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryos, pooled from 7 embryonic stages
Host: DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Average insert size 2 kb. For PCR insert analysis use forward and reverse primers. Library amplified recombinants (inserts): 98%; library complexity:5x10E6; full-length construction method: SMART (Clontech). Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).


Name: GISZF001_ha
Library ID: 2145
Organism: Danio rerio
Strain: wild type, Singapore strain
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryos, pooled from 7 embryonic stages
Host: DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Full-length construction method: SMART (Clontech). The pooled tissue RNA was collected and used to construct full length enriched cDNA library (GISZF001) and also served as template to synthesize complex first strand cDNA probe. Two high density colony arrays were made from over 110K cDNA clones and hybridized with the probes. Clones with high hybridization signals were selected as they represented highly abundant expressed clones. The hybridization intensities for all clones span from 0 to 1.8 million counts and the highly abundant class ranged from 210,000 to 1.8 million. Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).


Name: GISZF001_ma
Library ID: 2146
Organism: Danio rerio
Strain: wild type, Singapore strain
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryos, pooled from 7 embryonic stages
Host: DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Full-length construction method: SMART (Clontech). The pooled tissue RNA was collected and used to construct full length enriched cDNA library (GISZF001) and also served as template to synthesize complex first strand cDNA probe. Two high density colony arrays were made from over 110K cDNA clones and hybridized with the probes. Medium intensity clones were selected as they represented modest abundant expressed clones. The hybridization intensities for all clones span from 0 to 1.8 million counts and the medium abundant class ranged from 25,000 to 50,000. Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).


Name: GISZF001_ra
Library ID: 2147
Organism: Danio rerio
Strain: wild type, Singapore strain
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryos, pooled from 7 embryonic stages
Host: DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Priming method: Sfi-(dT)30 primed. Priming sequence: 5'- ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3'; directionally cloned into 5' cloning site (SfiA) using linker/adaptor sequence 5'- AAGCAGTGGTATCAACGCAGAGTGGCC-3' and 3' cloning site (SfiB) using Linker/adaptor sequence 5'-ATTCTAGAGGCCGAGGCGGCCGACATG(T)30VN-3' (same as the priming sequence). Full-length construction method: SMART (Clontech). The pooled tissue RNA was collected and used to construct full length enriched cDNA library (GISZF001) and also served as template to synthesize complex first strand cDNA probe. Two high density colony arrays were made from over 110K cDNA clones and hybridized with the probes. Low intensity clones were selected as they represented rare expressed clones. The hybridization intensities for all clones span from 0 to 1.8 million counts and the low abundance class ranged from 0 to 13,000. Library constructed by S. Mathavan, Chia-Lin Wei and Yijun Ruan (Genome Institute of Singapore).


Name: NCI_CGAP_ZEmb2
Library ID: 1928
Organism: Danio rerio
Strain: AB
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2 kb. Constructed by J. Wang (Research Genetics, Invitrogen Corp) from tissue donated by L. Zon (Harvard University). Note: this is a Zebrafish Gene Collection library.


Name: NCI_CGAP_ZEmb3
Library ID: 1929
Organism: Danio rerio
Strain: TUZF
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Constructed by J. Wang (Research Genetics, Invitrogen Corp) from tissue donated by L. Zon (Harvard University). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_15
Library ID: 2118
Organism: Danio rerio
Strain: wild type
Gender: both
Age: 0
Stage: embryo
Organ: embryo
Tissue: whole embryos staged from 2-8 hr postfertilization, approximately 2500 embryos total
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_18
Library ID: 2158
Organism: Danio rerio
Strain: wild type AB
Gender: both
Age: 0
Stage: embryo
Organ: embryo
Tissue: 1200 pooled embryos
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_32
Library ID: 2419
Organism: Danio rerio
Strain: wild type
Gender: both
Age: 0
Stage: embryo
Organ: embryo
Tissue: ZEM-2S embryo cell line (ATCC cat # CRL2147), 1000 cell blastula at 5 hrs postfertilization
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.9 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_46
Library ID: 2533
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without

RZPD 609

Name: RZPD 609
Library ID: 1733
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Tissue: gastrula stage
Host: XL-1 Blue
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library constructed using oligo-dT/NotI primer and cloned into EcoRI/NotI sites. This library consists of unique clones fingerprinted and picked from RZPD library 567. Fingerprinting and arraying by M. Clark (Max Planck Institute, Berlin). Library name in dbEST is Zebrafish_WashU_MPIMG_EST.

Zebrafish C32 14 somite embryo

Name: Zebrafish C32 14 somite embryo
Library ID: 1854
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Tissue: 14 somite embryo
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: 5' NotI/EcoRI 3'
Stop Codon Status: without
Description: First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

Zebrafish SJD 15 day embryo

Name: Zebrafish SJD 15 day embryo
Library ID: 1870
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

Zebrafish SJD 2 day embryo

Name: Zebrafish SJD 2 day embryo
Library ID: 1868
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

Zebrafish SJD 5 day embryo

Name: Zebrafish SJD 5 day embryo
Library ID: 1869
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

Zebrafish SJD day 3 embryo

Name: Zebrafish SJD day 3 embryo
Library ID: 1853
Organism: Danio rerio
Age: 0
Stage: embryo
Organ: embryo
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: 5' NotI/EcoRI 3'
Stop Codon Status: without
Description: First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library


Name: NIH_ZGC_9
Library ID: 2109
Organism: Danio rerio
Strain: Tubergin
Gender: both
Age: 0
Stage: embryo
Organ: eye
Tissue: neural retina, retinal pigment epithelium, lens and overlying skin, pooled embryos
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb, and is not amplified. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: This is a Zebrafish Gene Collection (ZGC) library

Zebrafish adult retina

Name: Zebrafish adult retina
Library ID: 1663
Organism: Danio rerio
Gender: both
Age: 0
Stage: adult
Organ: eye
Tissue: retinas
Host: GeneHogs DH10B
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/SalI 3'
Stop Codon Status: without
Description: Library constructed by and donated by Susan E. Brockerhoff, University of Washington (sbrocker@u.washington.edu).


Name: NIH_ZGC_30
Library ID: 2479
Organism: Danio rerio
Age: 0
Organ: fin
Tissue: fin blastema
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.92 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_31
Library ID: 2480
Organism: Danio rerio
Age: 0
Organ: fin
Tissue: early outgrowth fin
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.85 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

SJD adult pectoral fin

Name: SJD adult pectoral fin
Library ID: 1821
Organism: Danio rerio
Age: 0
Stage: adult
Organ: fin
Tissue: pectoral fin
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggtaacaacgcagagtacttt-ttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).

Zebrafish C32 fin

Name: Zebrafish C32 fin
Library ID: 1703
Organism: Danio rerio
Age: 0
Organ: fin
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Library constructed by Ning Wu (Research Genetics, Huntsville, AL).

Zebrafish fin day 1 regeneration

Name: Zebrafish fin day 1 regeneration
Library ID: 1750
Organism: Danio rerio
Gender: both
Age: 0
Organ: fin
Tissue: fin, regeneration after 1 day
Host: GeneHogs DH10B
Vector: pBK-CMV
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: First strand cDNA primed with 5'-GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT-3', followed by second strand synthesis, and ligated to 5' adaptors: 5'-AATTCGGCACGAG-3' and 3'-GCCGTGCTC-5'. cDNA was cloned directionally into ZAP-express lambda phage arms (Stratagene) and in vivo mass excised to obtain inserts in pBK-CMV phagemid. Library preparation by R. Lee.

Zebrafish fin day 3 regeneration

Name: Zebrafish fin day 3 regeneration
Library ID: 1751
Organism: Danio rerio
Gender: both
Age: 0
Organ: fin
Tissue: fin, 3 day regeneration
Host: GeneHogs DH10B
Vector: pBK-CMV
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: First strand cDNA primed with 5'-GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTT-3', followed by second strand synthesis, and ligated to 5' adaptors: 5'-AATTCGGCACGAG-3' and 3'-GCCGTGCTC-5'. cDNA was cloned directionally into ZAP-express lambda phage arms (Stratagene) and in vivo mass excised to obtain inserts in pBK-CMV phagemid. Library preparation by R. Lee.

Zebrafish SJD day 8 fin regeneration

Name: Zebrafish SJD day 8 fin regeneration
Library ID: 1764
Organism: Danio rerio
Gender: male
Age: 0
Organ: fin
Tissue: caudal fin, regeneration after 8 days
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).


Name: NIH_ZGC_22
Library ID: 2258
Organism: Danio rerio
Strain: AB
Gender: both
Age: 0
Stage: adult
Organ: gill
Tissue: 40 pooled samples
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer 5'-GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to a DraIII adaptor 5'-GGCCUACUGG-3', digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for >1.0 kb, with a average insert size of ~1.2 kb and is not amplified. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Reference for library construction: Methods Mol Bio 221:73-91. Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_16
Library ID: 2119
Organism: Danio rerio
Strain: wild type AB
Gender: male
Age: 0
Stage: adult
Organ: gut
Tissue: 13 pooled, includes stomach, intestine, liver and pancreas
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_45
Library ID: 2532
Organism: Danio rerio
Age: 0
Stage: adult
Organ: gut
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without


Name: NIH_ZGC_17
Library ID: 2151
Organism: Danio rerio
Strain: wild type
Gender: both
Age: 0
Stage: adult
Organ: heart
Tissue: 100 pooled samples
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.

Stainier zebrafish heart

Name: Stainier zebrafish heart
Library ID: 626
Organism: Danio rerio
Age: 0
Stage: adult
Organ: heart
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Library constructed by Dr. D. Stainier (University of California, San Francisco).


Name: NCI_CGAP_ZKid1
Library ID: 1930
Organism: Danio rerio
Age: 0
Organ: kidney
Tissue: normal kidney
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Constructed by J. Wang (Research Genetics, Invitrogen Corp) from tissue donated by L. Zon (Harvard University). Note: this is a Zebrafish Gene Collection library.

Zebrafish gridded kidney

Name: Zebrafish gridded kidney
Library ID: 1650
Organism: Danio rerio
Age: 0
Stage: adult
Organ: kidney
Tissue: kidney pooled from 300 adults
Host: GeneHogs DH10B
Vector: pBK-CMV
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Oligo dT cDNA library constructed from mRNA pooled from kidneys from 300 adult zebrafish. Library prepared by L. Zon.


Name: NIH_ZGC_25
Library ID: 2370
Organism: Danio rerio
Strain: WIK
Gender: both
Age: 1
Stage: adult
Organ: liver
Tissue: whole liver, pooled from 20 animals
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.7 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_8
Library ID: 2055
Organism: Danio rerio
Strain: AB
Gender: both
Age: 0
Stage: adult
Organ: liver
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers Recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Reference: Gene 200, 149-156, 1997. Note: this is a Zebrafish Gene Collection library.


Name: MPZFRiken1
Library ID: 2038
Organism: Danio rerio
Age: 0
Organ: mixed
Tissue: pool of intestine (2 individual samples) and liver
Host: DH10B TonA
Vector: pBluescriptR
Vector type: phagemid
Insert digest: 5' XhoI/BamHI 3'
Stop Codon Status: without
Description: Oligo-dT primed cDNA was produced from intestine (two independent samples) and liver using 5'-GAGAGAGAGAAGGATCCAAXXXXXXTTTTTTTTTTTTTTTTVN-3' with the following tags substituting for XXXXXX: CAAGAG (tag C04): liver; CGGTAT (tag C12): intestine; and CGTATG (tag D01): intestine. cDNA was pooled and size- selected for a 1.6 kb average insert. Library was constructed using the Cap- Trapper method as described in Genomics 2001: 77(1-2)79-90. Library donated by M. Pack, M.D. (University of Pennsylvania School of Medicine).


Name: NIH_ZGC_37
Library ID: 2498
Organism: Danio rerio
Age: 0
Stage: mixed
Organ: mixed
Tissue: whole embryo 5 somites, whole embryo 20 hpf, whole embryo 24 hpf, whole embryo 48 hpf, whole adult fish
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_ZGC_38
Library ID: 2499
Organism: Danio rerio
Age: 0
Stage: mixed
Organ: mixed
Tissue: whole embryo 5 somites, whole embryo 20 hpf, whole embryo 24 hpf, whole embryo 48 hpf, whole adult fish
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_ZGC_39
Library ID: 2500
Organism: Danio rerio
Age: 0
Stage: mixed
Organ: mixed
Tissue: whole embryo 5 somites, whole embryo 20 hpf, whole embryo 24 hpf, whole embryo 48 hpf, whole adult fish
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_ZGC_40
Library ID: 2501
Organism: Danio rerio
Age: 0
Stage: mixed
Organ: mixed
Tissue: whole embryo 5 somites, whole embryo 20 hpf, whole embryo 24 hpf, whole embryo 48 hpf, whole adult fish
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_ZGC_41
Library ID: 2502
Organism: Danio rerio
Age: 0
Stage: mixed
Organ: mixed
Tissue: pool of whole adult fish, ovary, brain, gut/internal organs and embryos
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_ZGC_42
Library ID: 2503
Organism: Danio rerio
Age: 0
Stage: mixed
Organ: mixed
Tissue: pool of whole adult fish, ovary, brain, gut/internal organs and embryos
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_ZGC_43
Library ID: 2504
Organism: Danio rerio
Age: 0
Stage: mixed
Organ: mixed
Tissue: pool of whole adult fish, ovary, brain, gut/internal organs and embryos
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_ZGC_44
Library ID: 2505
Organism: Danio rerio
Age: 0
Stage: mixed
Organ: mixed
Tissue: pool of whole adult fish, ovary, brain, gut/internal organs and embryos
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_XXX has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_ZGC_14
Library ID: 2150
Organism: Danio rerio
Gender: both
Age: 0
Stage: adult
Organ: olfactory epithelium
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.

zebrafish adult olfactory

Name: zebrafish adult olfactory
Library ID: 1753
Organism: Danio rerio
Gender: both
Age: 0
Stage: adult
Organ: olfactory epithelium
Tissue: olfactory rosettes
Host: GeneHogs DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Directionally cloned. Tissue source: olfactory tissue from pooled adults of both sexes. Library constructed by J. Ngai.

Campbell zebrafish ovary

Name: Campbell zebrafish ovary
Library ID: 1808
Organism: Danio rerio
Gender: female
Age: 0
Organ: ovary
Tissue: pooled
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Whole ovaries collected from zebrafish aged 4-5 months, 1 year and 2 years. Oligo-dT primed, directionally cloned. Average insert size 2 kb. Library constructed by Invitrogen and donated by R. Campbell (Marine Biology Laboratory, Woods Hole, MA).

Gong zebrafish ovary

Name: Gong zebrafish ovary
Library ID: 1777
Organism: Danio rerio
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: pooled ovaries (2 fish)
Host: DH10B TonA
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Poly A+ RNA was isolatd from the ovaries of 2 female adult zebrafish (4-5 month old). cDNAs were made using oligo-dT primers and inserted into lambda ZAP II vector (Stratagene) by Dr. Z. Gong, in vivo mass-excised to pBluescript SK- following the Washington University protocol (http://genome.wustl.edu/est/lambda_protocol.shtml). Please contact Zhiyuan Gong for further information on this library (National University of Singapore, Department of Biological Sciences, Lower Kent Ridge Road, Singapore 119260).


Name: NIH_ZGC_26
Library ID: 2371
Organism: Danio rerio
Strain: WIK
Gender: female
Age: 1
Stage: adult
Organ: ovary
Tissue: whole ovary, pooled from 25 animals
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for for an average insert size of 1.45 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_35
Library ID: 2421
Organism: Danio rerio
Strain: AB
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: pooled ovaries, including ooctyes and somatic tissue
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.7 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_49
Library ID: 2536
Organism: Danio rerio
Gender: female
Age: 0
Stage: adult
Organ: ovary
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without


Name: NIH_ZGC_5
Library ID: 2116
Organism: Danio rerio
Strain: Ekkwill Farms
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: contains eggs from one female, from all stages of development as well as support cells
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_21
Library ID: 2257
Organism: Danio rerio
Strain: AB
Gender: both
Age: 0
Stage: adult
Organ: skin
Tissue: 40 pooled samples
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer 5'-GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to a DraIII adaptor 5'-GGCCUACUGG-3', digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for >1.0 kb, with a average insert size of ~1.2 kb and is not amplified. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Reference for library construction: Methods Mol Bio 221:73-91. Note: this is a Zebrafish Gene Collection library.

Gong zebrafish testis

Name: Gong zebrafish testis
Library ID: 1776
Organism: Danio rerio
Gender: male
Age: 0
Stage: adult
Organ: testis
Tissue: pooled testes (from 31 fish)
Host: DH10B TonA
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Poly A+ RNA was isolatd from the testes of 31 male adult zebrafish (4-5 month old). cDNAs were made using oligo-dT primers and inserted into lambda ZAP II vector (Stratagene) by Dr. Z. Gong, in vivo mass-excised to pBluescript SK- following the Washington University protocol (http://genome.wustl.edu/est/lambda_protocol.shtml). Please contact Zhiyuan Gong for further information on this library (National University of Singapore, Department of Biological Sciences, Lower Kent Ridge Road, Singapore 119260).


Name: NIH_ZGC_23
Library ID: 2416
Organism: Danio rerio
Strain: X Tu
Gender: male
Age: 0
Stage: adult
Organ: testis
Tissue: whole testes, pooled
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI (3') and EcoRV (5') sites of pExpress-1 (EcoRV site destroyed upon ligation). Library has an average insert size of 1.7 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_6
Library ID: 2117
Organism: Danio rerio
Strain: Ekkwill Farms
Gender: male
Age: 0
Stage: adult
Organ: testis
Tissue: pooled
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_20
Library ID: 2159
Organism: Danio rerio
Strain: wild type AB
Gender: both
Age: 0
Stage: juvenile
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: the tissue for this library was originally annotated as pharyngeal arch; however upon sequence analysis it is suspected that this is not the correct tissue source. We have changed tissue to unknown source. Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_36
Library ID: 2493
Organism: Danio rerio
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pDeliver1.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: with
Description: ORFs flanked by multiple cloning sites (MCS) were amplified from fully sequence verified cDNA clones with PCR. Amplified products were separated by agarose gel electrophoresis, excised, purified and cloned into pDeliver01.1 using restriction digestion-ligation method. pDeliver01.1 is equivalent to Gateway pENTR221 vector. In addition to attL sites, there is also a pair of multiple cloning sites in between attL sites and ORFs. All clones were fully sequenced and verified. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggcttGAAGGAATTCGGTACC-ORF-CTCGAGTGCGGCCGCAacccagctttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to multiple cloning linker sequence. Clones from this library contain a stop codon, which is uniformed to be TAG. Clones were synthesized by Genecopeia (Germantown, MD) Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.


Name: NIH_ZGC_50
Library ID: 2537
Organism: Danio rerio
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: with


Name: NIH_ZGC_10
Library ID: 2052
Organism: Danio rerio
Strain: Tubergin
Age: 0
Stage: adult
Organ: whole body
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Bulk tissue was collected from a whole adult individual from the Tubergin strain. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double- stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for 1 kb fragments. A normalized version of this library is also available (NIH_ZGC_7). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_19
Library ID: 2156
Organism: Danio rerio
Strain: wild type
Age: 0
Stage: juvenile
Organ: whole body
Tissue: whole larvae
Host: DH10B TonA
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [GCGGCTGAAGACGGCCTATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [GGCCUACUGG], digested and directionally cloned into distinct DraIII sites of the pME18S-FL3. Library was size selected for 1.0 kb, with a average insert size of ~1.2kb. Library constructed by Yutaka Suzuki (University of Tokyo Institute of Medical Science). Custom primers recommended for sequencing: 5' end primer 5'-GGATGTTGCCTTTACTTCTA-3' and 3' end primer 5'-CGACCTGCAGCTCGAGCACA-3'. Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_27
Library ID: 2372
Organism: Danio rerio
Strain: WIK
Gender: both
Age: 0
Stage: juvenile
Organ: whole body
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.52 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_28
Library ID: 2373
Organism: Danio rerio
Gender: female
Age: 0
Stage: juvenile
Organ: whole body
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.7 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_29
Library ID: 2374
Organism: Danio rerio
Age: 0
Stage: juvenile
Organ: whole body
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3', double-stranded cDNA was cloned into the NotI and EcoRV sites of pExpress-1 (EcoRV site destroyed upon ligation). Library was size-selected for an average insert size of 1.5 kb. Primary library, non-amplified. Use M13(-21) to generate 3' end reads and M13R to generate 5' end reads. Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.


Name: NIH_ZGC_48
Library ID: 2535
Organism: Danio rerio
Age: 0
Stage: adult
Organ: whole body
Tissue: whole fish
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without


Name: NIH_ZGC_7
Library ID: 2051
Organism: Danio rerio
Gender: male
Age: 0
Stage: adult
Organ: whole body
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Bulk tissue was collected from a whole adult individual from the Tubergin strain. 1st strand cDNA was primed with a Not I - oligo(dT) primer, double-stranded cDNA was cloned into the Not I and EcoRV sites of pExpress-1. Library was size-selected for 1 kb fragments and normalized. A non-normalized version of this library is also available (NIH_ZGC_10). Library was constructed by Open Biosystems (Huntsville, AL). Note: this is a Zebrafish Gene Collection library.

Sugano SJD adult male

Name: Sugano SJD adult male
Library ID: 1812
Organism: Danio rerio
Gender: male
Age: 0
Stage: adult
Organ: whole body
Host: GeneHogs DH10B
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer [ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG). XhoI should be used to isolate the cDNA insert. Size selection was performed to exclude fragments <1.5kb. Library constructed and donated by Dr. Sumio Sugano (University of Tokyo Institute of Medical Science). Custom primers for sequencing: 5' end primer CTTCTGCTCTAAAAGCTGCG and 3' end primer CGACCTGCAGCTCGAGCACA.

Sugano-Kawakami DRA

Name: Sugano-Kawakami DRA
Library ID: 1333
Organism: Danio rerio
Strain: AB
Gender: both
Age: 0
Stage: adult
Organ: whole body
Tissue: whole body (including unfertilized eggs)
Host: GeneHogs DH10B
Vector: pME18S-FL3
Vector type: phagemid
Insert digest: 5' DraIII/DraIII 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with an oligo(dT) primer
[ATGTGGCCTTTTTTTTTTTTTTTTT]; double-stranded cDNA was ligated to a
DraIII adaptor [TGTTGGCCTACTGG], digested and cloned into distinct DraIII
sites of the pME18S-FL3 vector (5' site CACTGTGTG, 3' site CACCATGTG).
XhoI should be used to isolate the cDNA insert. Size selection was
performed to exclude fragments <1.5kb. Library constructed and donated
by Dr. Sumio Sugano and Dr. Ko-ichi Kawakami (University of Tokyo Institute
of Medical Science).
Custom primers for sequencing: 5' end primer
Suzuki, Y., Yoshitomo, K., Maruyama, K., Suyama, A., and Sugano,
S. Construction and characterization of a full length-enriched and a 5' end
enriched cDNA library. Gene 200, 149-156, 1997.

Zebrafish SJD adult male

Name: Zebrafish SJD adult male
Library ID: 1763
Organism: Danio rerio
Gender: male
Age: 0
Stage: adult
Organ: whole body
Host: GeneHogs DH10B
Vector: pZERO-2
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: First strand cDNA was primed using an oligo-dT adaptor primer with an XhoI site: 5'-gagagagagagagagagagaactagtctcgagtttttttttttttttttt-3'. Double-stranded cDNA was ligated to an EcoRI adaptor: 5'-aattcggcacgagg-3' and was digested with XhoI and directionally cloned into pZero-2. Library construction by Joe Barnes and Steve Johnson (Washington University).

Zebrafish SJD adult male II

Name: Zebrafish SJD adult male II
Library ID: 1822
Organism: Danio rerio
Gender: male
Age: 0
Stage: adult
Organ: whole body
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: First strand cDNA synthesis was primed using oligo-dT on magnetic beads with an additional primer 5'-gcggccgctaatacgactcacta-taggg-3'. Second strand synthesis was a 3-cycle PCR using the primers 5'-ggccgctaatacgactcactatag-3' and 5'aagcagtggtaacaacgcagagtactttttttttttttttvn-3'. cDNA was subsequently amplified in a 7-cycle PCR with the following primers: 5'-ggccgctaatacgactcactatag-3' and 5'-aagcagtggt-aacaacgcag. Deoxy-UMP adaptors were added in a third PCR (5 cycles) and the primers 5'-caucaucaucauggccgctaatacgactcactataggg-3' and 5'-cuacuacuacuaaagcagtggtaacaacgcagagtac-3'. Ends were treated with uracil DNA glycosylase and product with 3' overhangs was annealed to complementary ends of pAMP1. Insert can be excised using EcoRI and NotI. Library constructed by Joe Barnes and Steve Johnson (Washington University).