human (Homo sapiens) cDNA Library Information

  Boolean search type:

Instructions: Enter search term(s) and/or number range(s) to search in ORFeome Collaboration Collections: OCAA, OCAB, hORFeome V8.1 (species: human).   Detailed Instructions...

Information for 702 libraries (by tissue)


   1. NCI_CGAP_Lip2

adrenal gland

   2. NCI_CGAP_AA1
   3. NCI_CGAP_Adr1
   4. NCI_CGAP_Brn59
   5. NCI_CGAP_Phe1
   6. NIH_MGC_84


   10. NIH_MGC_48


   11. NIH_MGC_53
   12. NIH_MGC_93


   13. NIH_MGC_278
   14. NIH_MGC_279
   15. NIH_MGC_280
   16. NIH_MGC_281


   17. NCI_CGAP_CML1
   18. NIH_MGC_106
   19. NIH_MGC_157
   20. NIH_MGC_158
   21. NIH_MGC_2
   22. Soares NPBMC


   23. NCI_CGAP_DF0
   24. NCI_CGAP_DF1
   25. NCI_CGAP_ED0
   26. NCI_CGAP_ED1
   27. NCI_CGAP_EI0
   28. NCI_CGAP_EI1
   29. NCI_CGAP_Ew1
   30. NCI_CGAP_FG0
   31. NCI_CGAP_FG1
   32. NCI_CGAP_Fs1
   33. NCI_CGAP_Pr12
   34. NCI_CGAP_SS1
   35. NIH_MGC_86

bone marrow

   36. Jia bone marrow stroma
   37. NCI_CGAP_HSC1
   38. NCI_CGAP_HSC3
   39. NCI_CGAP_HSC4
   40. NIH_MGC_54
   41. NIH_MGC_55


   42. NCI_CGAP_Mel1
   43. NCI_CGAP_Mel3


   44. Clontech brain (HL3002s)
   45. Clontech fetal brain (HL3025s)
   46. COGENE 4AR (4EAR)
   47. COGENE PR (4EPR)
   48. Johnston frontal cortex
   49. Lehrach HBF
   50. Life Tech brain (10418-010)
   51. NCI_CGAP_Brn20
   52. NCI_CGAP_Brn21
   53. NCI_CGAP_Brn23
   54. NCI_CGAP_Brn25
   55. NCI_CGAP_Brn35
   56. NCI_CGAP_Brn41
   57. NCI_CGAP_Brn50
   58. NCI_CGAP_Brn52
   59. NCI_CGAP_Brn53
   60. NCI_CGAP_Brn55
   61. NCI_CGAP_Brn56
   62. NCI_CGAP_Brn57
   63. NCI_CGAP_Brn58
   64. NCI_CGAP_Brn60
   65. NCI_CGAP_Brn61
   66. NCI_CGAP_Brn62
   67. NCI_CGAP_Brn64
   68. NCI_CGAP_Brn65
   69. NCI_CGAP_Brn66
   70. NCI_CGAP_Brn67
   71. NCI_CGAP_Brn69
   72. NCI_CGAP_Brn70
   73. NCI_CGAP_CNS1
   74. NCI_CGAP_Pit1
   75. NCI_CGAP_Sch1
   76. NICHD_HS_Ut1
   77. NICHD_HS_Ut2
   78. NIH_MGC_114
   79. NIH_MGC_119
   80. NIH_MGC_121
   81. NIH_MGC_124
   82. NIH_MGC_126
   83. NIH_MGC_127
   84. NIH_MGC_128
   85. NIH_MGC_141
   86. NIH_MGC_142
   87. NIH_MGC_181
   88. NIH_MGC_19
   89. NIH_MGC_192
   90. NIH_MGC_227
   91. NIH_MGC_228
   92. NIH_MGC_229
   93. NIH_MGC_264
   94. NIH_MGC_266
   95. NIH_MGC_272
   96. NIH_MGC_274
   97. NIH_MGC_286
   98. NIH_MGC_287
   99. NIH_MGC_288
   100. NIH_MGC_289
   101. NIH_MGC_306
   102. NIH_MGC_307
   103. NIH_MGC_308
   104. NIH_MGC_309
   105. NIH_MGC_310
   106. NIH_MGC_311
   107. NIH_MGC_312
   108. NIH_MGC_313
   109. NIH_MGC_47
   110. NIH_MGC_56
   111. NIH_MGC_57
   112. NIH_MGC_73
   113. NIH_MGC_95
   114. NIH_MGC_96
   115. NIH_MGC_98
   116. Schiller astrocytoma
   117. Schiller glioblastoma multiforme
   118. Schiller meningioma
   119. Schiller oligodendroglioma
   120. Schneider fetal brain 00004
   121. Soares 1NIB
   122. Soares 2NbHMSP
   123. Soares N2b4HB55Y
   124. Soares N2b5HB55Y
   125. Soares NbHFB
   126. Stanley Frontal B/N pool 1
   127. Stanley Frontal B/N pool 2
   128. Stanley Frontal N/B pool 2
   129. Stanley Frontal N/S pool 2
   130. Stanley Frontal S/B pool 1
   131. Stanley Frontal S/N individual
   132. Stanley Frontal S/N pool 1
   133. Stanley Frontal S/N pool 2
   134. Stanley Hippocampus B/N pool 1
   135. Stanley Hippocampus B/S pool 1
   136. Stanley Hippocampus N/B pool 1
   137. Stanley Hippocampus N/S pool 1
   138. Stanley Hippocampus S/B pool 1
   139. Stanley Hippocampus S/N pool 1
   140. Stratagene fetal brain (937226)
   141. Stratagene mature hNT (937233)
   142. Stratagene NT2 neuroepithelium (937230)
   143. Stratagene NT2/RA neuroepithelium 937231
   144. Stratagene NT2/RA+MI neuroepith (937234)
   145. Stratagene schizophrenic brain S11


   146. NCI_CGAP_Br1
   147. NCI_CGAP_Br1.1
   148. NCI_CGAP_Br12
   149. NCI_CGAP_Br13
   150. NCI_CGAP_Br14
   151. NCI_CGAP_Br15
   152. NCI_CGAP_Br16
   153. NCI_CGAP_Br17
   154. NCI_CGAP_Br18
   155. NCI_CGAP_Br2
   156. NCI_CGAP_Br21
   157. NCI_CGAP_Br22
   158. NCI_CGAP_Br3
   159. NCI_CGAP_Br4
   160. NCI_CGAP_Br5
   161. NCI_CGAP_Br7
   162. NIH_MGC_107
   163. NIH_MGC_151
   164. NIH_MGC_159
   165. NIH_MGC_87
   166. Soares 2NbHBst
   167. Soares 3NbHBst


   168. NCI_CGAP_Car1
   169. NCI_CGAP_EU0
   170. NCI_CGAP_EU1
   171. NCI_CGAP_EZ0
   172. NCI_CGAP_EZ1
   173. NCI_CGAP_FE0
   174. NCI_CGAP_FE1
   175. NCI_CGAP_FH0
   176. NCI_CGAP_FH1
   177. NCI_CGAP_FL0
   178. NCI_CGAP_FL1


   179. Clontech HeLa S3 cells (HL3021s)
   180. NIH_MGC_12
   181. NIH_MGC_13
   182. NIH_MGC_35
   183. NIH_MGC_4
   184. NIH_MGC_5
   185. NIH_MGC_64
   186. Soares NHCe
   187. Soares NHCeC
   188. Stratagene HeLa S3 cells (937216)


   189. Morton fetal cochlea


   190. Barstead HPL-RB7
   191. NCI_CGAP_Co1
   192. NCI_CGAP_Co10
   193. NCI_CGAP_Co11
   194. NCI_CGAP_Co12
   195. NCI_CGAP_Co14
   196. NCI_CGAP_Co16
   197. NCI_CGAP_Co17
   198. NCI_CGAP_Co18
   199. NCI_CGAP_Co19
   200. NCI_CGAP_Co2
   201. NCI_CGAP_Co20
   202. NCI_CGAP_Co21
   203. NCI_CGAP_Co22
   204. NCI_CGAP_Co23
   205. NCI_CGAP_Co25
   206. NCI_CGAP_Co26
   207. NCI_CGAP_Co27
   208. NCI_CGAP_Co28
   209. NCI_CGAP_Co29
   210. NCI_CGAP_Co3
   211. NCI_CGAP_Co4
   212. NCI_CGAP_Co8
   213. NCI_CGAP_Co9
   214. NIH_MGC_15
   215. NIH_MGC_268
   216. NIH_MGC_276
   217. NIH_MGC_294
   218. NIH_MGC_295
   219. NIH_MGC_296
   220. NIH_MGC_297
   221. NIH_MGC_65
   222. Soares/Dieckgraefe NHCD
   223. Soares/Dieckgraefe NHUC
   224. Stratagene colon tumor (937204)
   225. Stratagene colon tumor (937221)

connective tissue

   226. NCI_CGAP_Sar4

embryonic stem cell

   227. NIA Human H1 Embryonic Stem Cells cDNA Library (Long)
   228. NIH_MGC_172
   229. NIH_MGC_193
   230. NIH_MGC_200
   231. NIH_MGC_201
   232. NIH_MGC_202
   233. NIH_MGC_239
   234. NIH_MGC_240
   235. NIH_MGC_258
   236. NIH_MGC_259
   237. NIH_MGC_260
   238. NIH_MGC_261
   239. NIH_MGC_262
   240. NIH_MGC_263

endothelial cell

   241. Stratagene endothelial cell (937223)


   242. NCI_CGAP_Eso2


   243. NIH_MGC_16
   244. NIH_MGC_43
   245. NIH_MGC_67
   246. Soares N2b4HR
   247. Soares N2b5HR
   248. Stratagene corneal stroma (937222)
   249. Stratagene fetal retina (937202)


   250. Soares Nb2HF8-9w


   251. Soares NbHSF
   252. Stratagene fibroblast (937212)


   253. NCI_CGAP_GU1

germ cell

   254. NCI_CGAP_GC1
   255. NCI_CGAP_GC2
   256. NCI_CGAP_GC3
   257. NCI_CGAP_GC4
   258. NCI_CGAP_GC5
   259. NCI_CGAP_GC6


   260. NCI_CGAP_HN5
   261. NCI_CGAP_HN6


   262. NIH_MGC_182


   263. COGENE 4PA1
   264. COGENE 6E MAN
   265. COGENE 6E MAX
   266. COGENE 8.5 EAT
   267. COGENE 8.5 EPT
   268. NCI_CGAP_HN20
   269. NCI_CGAP_HN21
   270. NIH_MGC_102


   271. Barstead HPL-RB3
   272. Barstead HPL-RB6
   273. Clontech heart (HL3026s)
   274. Life Tech heart (10419-018)
   275. NIH_MGC_74
   276. Soares NbHH19W


   277. Clontech kidney (HL3001s)
   278. Gessler Wilms' tumor
   279. Life Tech kidney (10420-016)
   280. NCI_CGAP_Kid1
   281. NCI_CGAP_Kid11
   282. NCI_CGAP_Kid12
   283. NCI_CGAP_Kid13
   284. NCI_CGAP_Kid3
   285. NCI_CGAP_Kid5
   286. NCI_CGAP_Kid6
   287. NCI_CGAP_Kid7
   288. NCI_CGAP_Kid8
   289. NIH_MGC_108
   290. NIH_MGC_14
   291. NIH_MGC_45
   292. NIH_MGC_58
   293. NIH_MGC_75
   294. NIH_MGC_80
   295. NIH_MGC_89


   296. NCI_CGAP_HN2
   297. NCI_CGAP_Lar1


   298. Life Tech leukocyte (10421-014)
   299. NIH_MGC_118


   300. Clontech fetal liver (HL3020s)
   301. Clontech liver (HL3006s)
   302. Life Tech liver (10422-012)
   303. NCI_CGAP_Gas2
   304. NCI_CGAP_Li1
   305. NCI_CGAP_Li2
   306. NCI_CGAP_Li5
   307. NCI_CGAP_Li8
   308. NCI_CGAP_Pr20
   309. NIH_MGC_100
   310. NIH_MGC_290
   311. NIH_MGC_291
   312. NIH_MGC_292
   313. NIH_MGC_293
   314. NIH_MGC_76
   315. NIH_MGC_90
   316. Stratagene liver (937224)


   317. Clontech fetal lung (HL3022s)
   318. Clontech lung (HL3004s)
   319. Life Tech lung (10424-018)
   320. NCI_CGAP_DH0
   321. NCI_CGAP_DH1
   322. NCI_CGAP_DI0
   323. NCI_CGAP_DT0
   324. NCI_CGAP_DT1
   325. NCI_CGAP_Lu1
   326. NCI_CGAP_Lu13
   327. NCI_CGAP_Lu19
   328. NCI_CGAP_Lu21
   329. NCI_CGAP_Lu24
   330. NCI_CGAP_Lu25
   331. NCI_CGAP_Lu26
   332. NCI_CGAP_Lu27
   333. NCI_CGAP_Lu28
   334. NCI_CGAP_Lu31
   335. NCI_CGAP_Lu34
   336. NCI_CGAP_Lu34.1
   337. NCI_CGAP_Lu5
   338. NCI_CGAP_Lu6
   339. NCI_CGAP_Lu7
   340. NIH_MGC_101
   341. NIH_MGC_18
   342. NIH_MGC_213
   343. NIH_MGC_214
   344. NIH_MGC_215
   345. NIH_MGC_265
   346. NIH_MGC_273
   347. NIH_MGC_298
   348. NIH_MGC_299
   349. NIH_MGC_300
   350. NIH_MGC_301
   351. NIH_MGC_59
   352. NIH_MGC_68
   353. NIH_MGC_69
   354. NIH_MGC_7
   355. NIH_MGC_77
   356. Soares NbHL19W
   357. Stratagene lung (937210)
   358. Stratagene lung carcinoma (937218)


   359. NIH_MGC_3
   360. NIH_MGC_36
   361. NIH_MGC_37
   362. NIH_MGC_38
   363. NIH_MGC_50
   364. NIH_MGC_51
   365. NIH_MGC_52
   366. NIH_MGC_63
   367. NIH_MGC_8
   368. NIH_MGC_85
   369. NIH_MGC_99

lymph node

   370. NCI_CGAP_HN1
   371. NCI_CGAP_HSC2
   372. NCI_CGAP_Lym12
   373. NCI_CGAP_Lym3
   374. NCI_CGAP_Lym5
   375. NCI_CGAP_Lym6


   376. NCI_CGAP_FT0
   377. NCI_CGAP_FT1
   378. NCI_CGAP_FT2


   379. DFCI-Vidal horfeome 1.1
   380. MAPcL
   381. NCI_CGAP_Sub1
   382. NCI_CGAP_Sub2
   383. NCI_CGAP_Sub3
   384. NCI_CGAP_Sub4
   385. NCI_CGAP_Sub5
   386. NCI_CGAP_Sub6
   387. NCI_CGAP_Sub7
   388. NCI_CGAP_Sub8
   389. NCI_CGAP_Sub9
   390. NIH_MGC_115
   391. NIH_MGC_116
   392. NIH_MGC_117
   393. NIH_MGC_120
   394. NIH_MGC_122
   395. NIH_MGC_146
   396. NIH_MGC_184
   397. NIH_MGC_186
   398. NIH_MGC_187
   399. NIH_MGC_195
   400. NIH_MGC_217
   401. NIH_MGC_218
   402. NIH_MGC_219
   403. NIH_MGC_220
   404. NIH_MGC_221
   405. NIH_MGC_241
   406. NIH_MGC_244
   407. NIH_MGC_245
   408. NIH_MGC_271
   409. NIH_MGC_277
   410. NIH_MGC_282
   411. NIH_MGC_283
   412. NIH_MGC_314
   413. NIH_MGC_315
   414. NIH_MGC_316
   415. NIH_MGC_317
   416. NIH_MGC_318
   417. NIH_MGC_319
   418. NIH_MGC_320
   419. NIH_MGC_321
   420. NIH_MGC_322
   421. NIH_MGC_323
   422. NIH_MGC_324
   423. NIH_MGC_325
   424. NIH_MGC_326
   425. NIH_MGC_327
   426. NIH_MGC_328
   427. NIH_MGC_329
   428. NIH_MGC_330
   429. NIH_MGC_332
   430. NIH_MGC_333
   431. NIH_MGC_334
   432. NIH_MGC_335
   433. NIH_MGC_336
   434. NIH_MGC_337
   435. NIH_MGC_338
   436. NIH_MGC_339
   437. NIH_MGC_340
   438. NIH_MGC_341
   439. NIH_MGC_342
   440. NIH_MGC_343
   441. NIH_MGC_344
   442. NIH_MGC_345
   443. NIH_MGC_346
   444. NIH_MGC_347
   445. NIH_MGC_348
   446. NIH_MGC_349
   447. NIH_MGC_350
   448. NIH_MGC_351
   449. NIH_MGC_352
   450. NIH_MGC_353
   451. NIH_MGC_354
   452. NIH_MGC_355
   453. NIH_MGC_356
   454. NIH_MGC_357
   455. NIH_MGC_358
   456. NIH_MGC_359
   457. NIH_MGC_360
   458. NIH_MGC_361
   459. NIH_MGC_362
   460. NIH_MGC_363
   461. NIH_MGC_364
   462. NIH_MGC_397
   463. NIH_MGC_398
   464. Soares 1NFLS
   465. Soares 1NFLS-S1
   466. Soares NbHPU
   467. Soares NFL_T_GBC_S1
   468. Soares NhHMPu-S1
   469. Soares NSF-F8-9W-OT-PA-P-S1


   470. NCI_CGAP_HN10
   471. NCI_CGAP_HN15
   472. NCI_CGAP_HN16
   473. NCI_CGAP_HN7
   474. NCI_CGAP_HN8
   475. NCI_CGAP_HN9


   476. Barstead HPL-RB8
   477. Clontech muscle (HL3000s)
   478. NCI_CGAP_Alv1
   479. NCI_CGAP_AR1
   480. NIH_MGC_123
   481. NIH_MGC_17
   482. NIH_MGC_183
   483. NIH_MGC_81
   484. Stratagene skeletal muscle (937209)

olfactory epithelium

   485. Weizmann olfactory epithelium


   486. NCI_CGAP_Ov1
   487. NCI_CGAP_Ov10
   488. NCI_CGAP_Ov11
   489. NCI_CGAP_Ov18
   490. NCI_CGAP_Ov2
   491. NCI_CGAP_Ov23
   492. NCI_CGAP_Ov26
   493. NCI_CGAP_Ov31
   494. NCI_CGAP_Ov32
   495. NCI_CGAP_Ov33
   496. NCI_CGAP_Ov34
   497. NCI_CGAP_Ov35
   498. NCI_CGAP_Ov36
   499. NCI_CGAP_Ov37
   500. NCI_CGAP_Ov38
   501. NCI_CGAP_Ov39
   502. NCI_CGAP_Ov40
   503. NCI_CGAP_Ov41
   504. NCI_CGAP_Ov5
   505. NCI_CGAP_Ov6
   506. NCI_CGAP_Ov8
   507. NICHD_Hs_Ov1
   508. NIH_MGC_109
   509. NIH_MGC_125
   510. NIH_MGC_66
   511. NIH_MGC_9
   512. Soares NbHOT
   513. Stratagene ovary (937217)
   514. Stratagene ovary tumor (937219)


   515. Barstead HPL-RB1
   516. HR85 islet
   517. Human insulinoma
   518. Melton human islets HIZ1
   519. Melton human pancreatic islets
   520. Melton normalized human islet 4 N4-HIS1
   521. NCI_CGAP_Pan1
   522. NCI_CGAP_Pan3
   523. NCI_CGAP_PI1
   524. NIH_MGC_110
   525. NIH_MGC_39
   526. NIH_MGC_42
   527. NIH_MGC_70
   528. NIH_MGC_78
   529. Stratagene pancreas tumor (937208)
   530. Takeda/Bell pancreatic islet


   531. Soares NbHPA

peripheral nervous system

   532. Human Anterior Horn
   533. Lupski dorsal root ganglion
   534. Lupski sciatic nerve
   535. Lupski sympathetic trunk
   536. NCI_CGAP_PNS1


   537. NCI_CGAP_HN17
   538. NCI_CGAP_HN18
   539. NCI_CGAP_HN19
   540. NCI_CGAP_HN4

pineal gland

   541. Soares 1NbHPG
   542. Soares 3NbHPG

pituitary gland

   543. NIH_MGC_179


   544. Gatewood hydatidiform mole
   545. NIH_MGC_10
   546. NIH_MGC_11
   547. NIH_MGC_147
   548. NIH_MGC_148
   549. NIH_MGC_21
   550. NIH_MGC_302
   551. NIH_MGC_303
   552. NIH_MGC_304
   553. NIH_MGC_305
   554. NIH_MGC_79
   555. Soares 2NbHP8-9W
   556. Soares Nb2HP
   557. Stratagene placenta (937225)


   558. Barstead HPL-RB4
   559. Barstead HPL-RB4.1
   560. NCI_CGAP_Pr1
   561. NCI_CGAP_Pr10
   562. NCI_CGAP_Pr11
   563. NCI_CGAP_Pr13
   564. NCI_CGAP_Pr14
   565. NCI_CGAP_Pr15
   566. NCI_CGAP_Pr16
   567. NCI_CGAP_Pr17
   568. NCI_CGAP_Pr18
   569. NCI_CGAP_Pr19
   570. NCI_CGAP_Pr2
   571. NCI_CGAP_Pr21
   572. NCI_CGAP_Pr22
   573. NCI_CGAP_Pr23
   574. NCI_CGAP_Pr24
   575. NCI_CGAP_Pr25
   576. NCI_CGAP_Pr28
   577. NCI_CGAP_Pr3
   578. NCI_CGAP_Pr4
   579. NCI_CGAP_Pr4.1
   580. NCI_CGAP_Pr5
   581. NCI_CGAP_Pr6
   582. NCI_CGAP_Pr7
   583. NCI_CGAP_Pr8
   584. NCI_CGAP_Pr9
   585. NCI_CGAP_RDF1
   586. NCI_CGAP_RDF2
   587. NIH_MGC_111
   588. NIH_MGC_210
   589. NIH_MGC_40
   590. NIH_MGC_60
   591. NIH_MGC_83
   592. NIH_MGC_91


   593. NCI_CGAP_Mel15
   594. NCI_CGAP_Skn1
   595. NCI_CGAP_Skn3
   596. NCI_CGAP_Skn4
   597. NIH_MGC_112
   598. NIH_MGC_20
   599. NIH_MGC_41
   600. NIH_MGC_49
   601. NIH_MGC_62
   602. NIH_MGC_72
   603. Soares 2NbHM

small intestine

   604. NIH_MGC_88

soft tissue

   605. NCI_CGAP_Lei2


   606. Barstead HPL-RB2
   607. Life Tech spleen (10425-015)
   608. NIH_MGC_113
   609. Stratagene fetal spleen (937205)


   610. NCI_CGAP_Gas1
   611. NCI_CGAP_Gas4
   612. NCI_CGAP_St3

synthesized DNA

   613. NIH_MGC_242
   614. NIH_MGC_243
   615. NIH_MGC_369
   616. NIH_MGC_370
   617. NIH_MGC_371
   618. NIH_MGC_372
   619. NIH_MGC_425
   620. NIH_MGC_428
   621. NIH_MGC_435
   622. NIH_MGC_479
   623. NIH_MGC_480
   624. NIH_MGC_481
   625. NIH_MGC_486


   626. NIH_MGC_191


   627. Barstead HPL-RB5
   628. Life Tech testis (10426-013)
   629. NIH_MGC_180
   630. NIH_MGC_267
   631. NIH_MGC_275
   632. NIH_MGC_373
   633. NIH_MGC_374
   634. NIH_MGC_375
   635. NIH_MGC_376
   636. NIH_MGC_61
   637. NIH_MGC_82
   638. NIH_MGC_92
   639. NIH_MGC_97
   640. Soares NHT


   641. NCI_CGAP_Thym1
   642. Soares NHFTh


   643. NCI_CGAP_Thy1
   644. NCI_CGAP_Thy10
   645. NCI_CGAP_Thy11
   646. NCI_CGAP_Thy12
   647. NCI_CGAP_Thy3
   648. NCI_CGAP_Thy4
   649. NCI_CGAP_Thy5
   650. NCI_CGAP_Thy6
   651. NCI_CGAP_Thy7
   652. NCI_CGAP_Thy8
   653. NCI_CGAP_Thy9


   654. NCI_CGAP_HN11
   655. NCI_CGAP_HN12
   656. NCI_CGAP_HN13
   657. NCI_CGAP_HN14
   658. NCI_CGAP_HN3


   659. NIH_MGC_173
   660. NIH_MGC_194


   661. CCSB-DFCI hORFeome collection
   662. DFCI-Kazusa.orf
   663. DFCI-RIKEN.orf
   664. DKFZo001
   665. DKFZo002
   666. DKFZo003
   667. DKFZo004
   668. DKFZo005
   669. DKFZo006
   670. DKFZo007
   671. DKFZo008
   672. DKFZo009
   673. DKFZo010
   674. DKFZo011
   675. DKFZo012
   676. DKFZo013
   677. DKFZo014
   678. HIP_Gateway201_closed
   679. HIP_Gateway201_fusion
   680. HIP_Gateway221_closed
   681. HIP_Gateway221_fusion
   682. hORFeome v.3.1
   683. Kazusa-KIAA-pBCSK+
   684. Kazusa-KIAA-pBluescriptIISK+
   685. NIH_MGC_403
   686. NIH_MGC_404
   687. NIH_MGC_405
   688. NIH_MGC_406
   689. NIH_MGC_417
   690. NIH_MGC_422
   691. NIH_MGC_423
   692. NIH_MGC_424
   693. WTSI-chORF
   694. WTSI-ohORF


   695. NCI_CGAP_Ut1
   696. NCI_CGAP_Ut2
   697. NCI_CGAP_Ut3
   698. NCI_CGAP_Ut4
   699. NCI_CGAP_Ut7
   700. NIH_MGC_44
   701. NIH_MGC_46
   702. NIH_MGC_71


Name: NCI_CGAP_Lip2
Library ID: 470
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: adipose
Tissue: liposarcoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from liposarcoma, cDNA made by oligo-dT priming. Non- directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 426
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: adrenal gland
Tissue: two pooled adenomas
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Two pooled bulk adrenal adenomas. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.6 kb. Note: this is aNCI_CGAP Library.


Name: NCI_CGAP_Adr1
Library ID: 1469
Organism: Homo sapiens
Age: 0
Organ: adrenal gland
Tissue: neuroblastoma
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn59
Library ID: 1523
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: adrenal gland
Tissue: normal adrenal gland
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without


Name: NCI_CGAP_Phe1
Library ID: 544
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: adrenal gland
Tissue: pheochromocytoma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pheochromocytoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.3 kb. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_84
Library ID: 1710
Organism: Homo sapiens
Age: 0
Organ: adrenal gland
Tissue: adrenal cortex, carcinoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.229 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.


Library ID: 976
Organism: Homo sapiens
Age: 0
Organ: B-cell
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATTGCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Library ID: 635
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: B-cell
Tissue: pooled flow-sorted tonsil
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Germinal center B-cells Library constructed by Dr. L. Staudt (NCI). 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.1 kb. Note: this is a NCI_CGAP Library.


Library ID: 361
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: B-cell
Tissue: flow-sorted tonsils
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from germinal B-cells (flow-sortedfrom tonsils) provided by Dr. Louis Staudt of the NCI, and was then primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCTCATTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo. This library was previously referred to as Soares NbHTGBC. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_48
Library ID: 1655
Organism: Homo sapiens
Age: 0
Organ: B-cell
Tissue: primary B-cells from tonsils, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_53
Library ID: 1581
Organism: Homo sapiens
Age: 0
Organ: bladder
Tissue: carcinoma cell line
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.55 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_93
Library ID: 1729
Organism: Homo sapiens
Age: 0
Organ: bladder
Tissue: transitional cell papilloma, cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.7 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.


Name: NIH_MGC_278
Library ID: 2217
Organism: Homo sapiens
Gender: male
Age: 0
Stage: embryo
Organ: Blastocyst
Tissue: pluripotent cell line derived from blastocyst inner cell mass
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-1.14, NIH Registry designation UC01. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence. Passage 35. This line is a subclone of the parental line; the parental line was subcloned to remove aneuploid cells). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.9 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_279) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_279
Library ID: 2218
Organism: Homo sapiens
Gender: male
Age: 0
Stage: embryo
Organ: Blastocyst
Tissue: pluripotent cell line derived from blastocyst inner cell mass
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-1.14, NIH Registry designation UC01. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence. Passage 35. This line is a subclone of the parental line; the parental line was subcloned to remove aneuploid cells). cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.82 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_278) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_280
Library ID: 2219
Organism: Homo sapiens
Gender: female
Age: 0
Stage: embryo
Organ: Blastocyst
Tissue: pluripotent cell line derived from blastocyst inner cell mass
Host: DH10B
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-6, NIH Registry designation UC06. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence Passage 62. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.8 kb. This primary library is non-normalized (normalized primary library is NIH_MGC_281) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_281
Library ID: 2220
Organism: Homo sapiens
Gender: female
Age: 0
Stage: embryo
Organ: Blastocyst
Tissue: pluripotent cell line derived from blastocyst inner cell mass
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA obtained from pluripotent cell line derived from blastocyst inner cell mass (cell line HSF-6, NIH Registry designation UC06. Positive for OCT4 expression by rtPCR, positive for SSEA-3, SSEA-4, Tra-1-81, Tra-1-60 by immunofluorescence. Negative for SSEA-1 by immunofluorescence Passage 62. cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 2.0 kb. This primary library is normalized (non-normalized primary library is NIH_MGC_280) and was constructed by Express Genomics (Frederick, MD). Note: this is a Mammalian Gene Collection library.


Library ID: 1360
Organism: Homo sapiens
Age: 0
Organ: blood
Tissue: myeloid cells, 18 pooled CML cases, BCR/ABL rearrangement positive, includes both chronic phase and myeloid blast crisis
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies, catalog #11998-010. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_106
Library ID: 1756
Organism: Homo sapiens
Age: 0
Organ: blood
Tissue: natural killer cells, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_157
Library ID: 2004
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: blood
Tissue: Blood, promyelocytic leukemia
Host: DH10B TonA
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5' adaptor: GGCACGAG(G). Library constructed by Genome Therapeutics Corp. Tissue contributed by Narayan K. Bhat using ZAP-cDNA synthesis kit (Stratagene).


Name: NIH_MGC_158
Library ID: 2010
Organism: Homo sapiens
Age: 0
Stage: mixed
Organ: blood
Tissue: Blood, promyelocytic leukemia
Host: DH10B TonA
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5' adaptor: GGCACGAG(G). Library constructed by Genome Therapeutics Corp. Tissue contributed by Narayan K. Bhat using ZAP-cDNA synthesis kit (Stratagene).


Name: NIH_MGC_2
Library ID: 1418
Organism: Homo sapiens
Age: 0
Organ: blood
Tissue: blood from T-cell leukemia, cell line
Host: GeneHogs DH10B
Vector: pOTB7a
Vector type: plasmid
Insert digest: 5' CeuI/SceI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 700 bp. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library.

Soares NPBMC

Name: Soares NPBMC
Library ID: 1659
Organism: Homo sapiens
Age: 0
Organ: blood
Tissue: lymphocytes
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT)primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGGGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized; constructed in the laboratory of M. Bento Soares (University of Iowa).


Library ID: 1913
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: bone
Tissue: subchondral bone
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTAAGCGTCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DF1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 1914
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: bone
Tissue: subchondral bone
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTAAGCGTCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_DF0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 1920
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: bone
Tissue: chondrosarcoma, left pubic bone, cell line CS5
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGCTCAAGGCTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_ED1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 1921
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: bone
Tissue: chondrosarcoma, left pubic bone, cell line CS5
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGCTCAAGGCTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_ED0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 1922
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: bone
Tissue: chondrosarcoma, left pelvis
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACACTTGCACTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_EI1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 1923
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: bone
Tissue: chondrosarcoma, left pelvis
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACACTTGCACTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_EI0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Name: NCI_CGAP_Ew1
Library ID: 475
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: bone
Tissue: Ewing`s sarcoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from Ewing's sarcoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 2080
Organism: Homo sapiens
Age: 0
Organ: bone
Tissue: enchondroma, pool of 2
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGGTCACTCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FG1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2081
Organism: Homo sapiens
Age: 0
Organ: bone
Tissue: enchondroma, pool of 2
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGGTCACTCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_FG0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Name: NCI_CGAP_Fs1
Library ID: 1924
Organism: Homo sapiens
Age: 0
Organ: bone
Tissue: fibrosarcoma, cell line HT-1088 (ATCC #CCL-121)
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGTTCTACGAGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Name: NCI_CGAP_Pr12
Library ID: 468
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: bone
Tissue: prostate tumor metastasis to bone
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from metastatic prostate lesion of the bone, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 542
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: bone
Tissue: synovial sarcoma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Synovial sarcoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.4 kb. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_86
Library ID: 1712
Organism: Homo sapiens
Age: 0
Organ: bone
Tissue: osteosarcoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.533 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.

Jia bone marrow stroma

Name: Jia bone marrow stroma
Library ID: 528
Organism: Homo sapiens
Gender: both
Age: 0
Stage: mixed
Organ: bone marrow
Tissue: stroma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: mRNA made from human bone marrow stroma, cDNA made by oligo-dT priming. Directionally cloned. Size-selected for average insert size 0.5 kb. Library constructed by Dr. Libin Jia (NHGRI).


Library ID: 541
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: bone marrow
Tissue: flow-sorted, CD34+/CD38- hematopoietic stem cells
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from flow-sorted CD34+/CD38- hematopoietic stem cells, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1324
Organism: Homo sapiens
Age: 0
Organ: bone marrow
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from lymphoid tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1325
Organism: Homo sapiens
Age: 0
Organ: bone marrow
Tissue: stem cell CD34+, CD38-
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from lymphoid tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_54
Library ID: 1582
Organism: Homo sapiens
Age: 0
Organ: bone marrow
Tissue: chronic myelogenous leukemia, cell line
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.75 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_55
Library ID: 1583
Organism: Homo sapiens
Age: 0
Organ: bone marrow
Tissue: acute myelogenous leukemia cell line
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.9-4.0 kb). 14/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NCI_CGAP_Mel1
Library ID: 738
Organism: Homo sapiens
Age: 0
Organ: bowel
Tissue: metastatic melanoma
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Life Technologies catalog #: 10980-019 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Mel3
Library ID: 785
Organism: Homo sapiens
Age: 0
Organ: bowel
Tissue: metastatic melanoma to bowel
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 0.9 kb. Life Technologies catalog #: 10981-017 Note: this is a NCI_CGAP Library.

Clontech brain (HL3002s)

Name: Clontech brain (HL3002s)
Library ID: 69
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: brain/CNS
Host: MC1061/P3
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' BstXI/NotI 3'
Stop Codon Status: without

Clontech fetal brain (HL3025s)

Name: Clontech fetal brain (HL3025s)
Library ID: 73
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: brain/CNS
Host: MC1061/P3
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' BstXI/NotI 3'
Stop Codon Status: without


Library ID: 1779
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: anterior rhombomeres (5-8) pooled from 4 embryos.
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.3-1.6 kb. Normalized to Cot10. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at


Library ID: 1778
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: posterior rhombomeres (5-8) pooled from 4 embryos.
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-2.0 kb. Normalized to Cot10. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at

Johnston frontal cortex

Name: Johnston frontal cortex
Library ID: 742
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: frontal cortex, pool of 4
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: EcoRI
Stop Codon Status: without
Description: Stanley Neuropathology Consortium ( brains S-58, S-65, S-67, S-78. Random + oligo-dT primed into EcoRI site of ZAP II Vector. Mass excised. Avg insert length 1.9kb. Non-directionally cloned. Custom library provided by Dr. Nancy Johnston [(410) 614-3918,].

Lehrach HBF

Name: Lehrach HBF
Library ID: 80
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: brain/CNS
Host: XL1
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: directionally cloned

Life Tech brain (10418-010)

Name: Life Tech brain (10418-010)
Library ID: 110
Organism: Homo sapiens
Gender: female
Age: 36
Stage: adult
Organ: brain/CNS
Tissue: whole brain
Host: DH12S
Vector: pCMV-SPORT
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: directionally cloned, average insert size 1.38 kb


Name: NCI_CGAP_Brn20
Library ID: 1306
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: oligodendroglioma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from oligodendroglioma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. CITATION: National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index CONT_NAME: Robert Strausberg, Ph.D. COMMENT: cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. cDNA Library Arrayed by: I.M.A.G.E. Consortium, LLNL DNA Sequencing by: Washington University Genome Sequencing Center Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn21
Library ID: 1326
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: oligodendroglioma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from brain tumor tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn23
Library ID: 965
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: glioblastoma, pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATATCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn25
Library ID: 1110
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: anaplastic oligodendroglioma
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATAGGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn35
Library ID: 1273
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: pool of 5 tumors: meningioma, oligodendroglioma, astrocytoma (grade II), medulloblastoma, astrocytoma (grade IV)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.33 kb. Tumor types include: meningioma, oligodendroglioma, astrocytoma (grade II), medulloblastoma, astrocytoma (grade IV). Life Technologies catalog #: 11544-012 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn41
Library ID: 1458
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: oligodendroglioma
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATCACTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed and normalized by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn50
Library ID: 1370
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: medulloblastoma
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from medulloblastoma tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTTTCGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. This library is normalized. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn52
Library ID: 1331
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: pool of 5 tumors: meningioma, oligodendroglioma, astrocytoma (grade II), medulloblastoma, astrocytoma (grade IV)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This library represents the normalized version of NCI_CGAP_Brn35. Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.19 kb. Tumor types include: meningioma, oligodendroglioma, astrocytoma (grade II), medulloblastoma, astrocytoma (grade IV). Constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn53
Library ID: 1356
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: meningioma, pool of 3
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies, catalog #12005-013. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn55
Library ID: 1403
Organism: Homo sapiens
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: pediatric neuroblastoma, stage 3
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without


Name: NCI_CGAP_Brn56
Library ID: 1520
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: ganglioneuroma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without


Name: NCI_CGAP_Brn57
Library ID: 1521
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: pediatric neuroblastoma, grade IV
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without


Name: NCI_CGAP_Brn58
Library ID: 1522
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: neuroblastoma, stage IV
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without


Name: NCI_CGAP_Brn60
Library ID: 1524
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: pediatric neuroblastoma, grade IV
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without


Name: NCI_CGAP_Brn61
Library ID: 1525
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: pediatric neuroblastoma, grade II
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without


Name: NCI_CGAP_Brn62
Library ID: 1526
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: pediatric neuroblastoma, grade III
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without


Name: NCI_CGAP_Brn64
Library ID: 1668
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: glioblastoma, with EGFR amplification
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.57 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn65
Library ID: 1669
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: glioblastoma, without EGFR amplification
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.77 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn66
Library ID: 1670
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: brain, glioblastoma with probable TP53 mutation and no EGFR amplification
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.64 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn67
Library ID: 1671
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: anaplastic oligodendroglioma with 1p/19q loss
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.3 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Brn69
Library ID: 1719
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: glioblastoma
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.969 kb. Library constructed by Life Technologies. Note: This is an NCI_CGAP library.


Name: NCI_CGAP_Brn70
Library ID: 1667
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: anaplastic oligodendroglioma
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.9 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Library ID: 730
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: substantia nigra
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.0 kb. Life Technologies catalog #: 10979-011 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pit1
Library ID: 1358
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: pituitary adenoma, 4 pooled
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.7 kb. Library constructed by Life Technologies, catalog #12001-012. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Sch1
Library ID: 425
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: Schwannoma tumors - two bulk tumors
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Two pooled bulk Schwannoma tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.2 kb. Note: this is a NCI_CGAP Library.


Name: NICHD_HS_Ut1
Library ID: 1892
Organism: Homo sapiens
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from microquantity amounts of mRNA from normal endometrial tissue (late proliferative phase, cycle day 13). Average insert size 1.9 kb. Library constructed by ResGen (Invitrogen Corporation).


Name: NICHD_HS_Ut2
Library ID: 1893
Organism: Homo sapiens
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally from microquantity amounts of mRNA from normal endometrial tissue (mid-secretory phase, cycle day 23). Average insert size 1.6 kb. Library constructed by ResGen (Invitrogen Corporation).


Name: NIH_MGC_114
Library ID: 1783
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: pool of 6 brains
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source anonymous pool of 6 male brains, age range 23-27 yo. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.5 kb, insert size range 1-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 019. Note: this is a NIH_MGC Library.


Name: NIH_MGC_119
Library ID: 1788
Organism: Homo sapiens
Gender: male
Age: 27
Stage: adult
Organ: brain/CNS
Tissue: normal medulla
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source normal medulla from anonymous male age 27. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.3 kb, insert size range 0.9-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 013. Note: this is a NIH_MGC Library.


Name: NIH_MGC_121
Library ID: 1790
Organism: Homo sapiens
Gender: both
Age: 0
Stage: fetal
Organ: brain/CNS
Tissue: pool of 3 fetal brains
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source anonymous pool of 3 fetal brains, female age 20 weeks, female age 24 weeks, and male age 26 weeks. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.7 kb, insert size range 0.7-3.5 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 017. Note: this is a NIH_MGC Library.


Name: NIH_MGC_124
Library ID: 1861
Organism: Homo sapiens
Gender: male
Age: 27
Stage: adult
Organ: brain/CNS
Tissue: hippocampus
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source male hippocampus, age 27. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.4 kb, insert size range 0.9-4 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 012. Note: this is a NIH_MGC Library.


Name: NIH_MGC_126
Library ID: 1889
Organism: Homo sapiens
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.5-1 kb size fraction (other fractions present in NIH_MGC_127 and NIH_MGC_128). Library created in the laboratory of T. Usdin, M.D., Ph.D. (NIMH, NIH). Note: this is a NIH_MGC Library.


Name: NIH_MGC_127
Library ID: 1890
Organism: Homo sapiens
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 1-2 kb size fraction (other fractions present in NIH_MGC_126 and NIH_MGC_128). Library created in the laboratory of T. Usdin, M.D., Ph.D. (NIMH, NIH). Note: this is a NIH_MGC Library.


Name: NIH_MGC_128
Library ID: 1891
Organism: Homo sapiens
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5'' and 3'' adaptors were used in cloning as follows: 5''-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3'' and 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3''. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the >2 kb size fraction (other fractions present in NIH_MGC_126 and NIH_MGC_127). Library created in the laboratory of T. Usdin, M.D., Ph.D. (NIMH, NIH). Note: this is a NIH_MGC Library.


Name: NIH_MGC_141
Library ID: 1958
Organism: Homo sapiens
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' and 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3'. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the 0.2-0.5 kb size fraction (other fractions present in NIH_MGC_142). Library created in the laboratory of M. Brownstein (NIMH, NIH). Note: this is a NIH_MGC Library.


Name: NIH_MGC_142
Library ID: 1959
Organism: Homo sapiens
Gender: both
Age: 0
Stage: embryo
Organ: brain/CNS
Tissue: normal brain, pooled
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from a pool of 40 cell line polyA+ RNAs (bladder - 2%, blood - 33.4%, brain - 5.6%, breast - 12.5%, colon - 4%, connective tissue - 1.4%, eye - 1%, intestine - 2.6%, kidnney - 2.2%, liver - 5.7%, lung - 10.8%, NK-cell - 5.2%, ovary - 4%, pharynx - 2.5%, prostate - 4.3%, salivary gland - 1.3%, and skin - 2.3%). 5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' and 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)NN-3'. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected to contain the >0.5 kb size fraction (other fractions present in NIH_MGC_141). Library created in the laboratory of M. Brownstein (NIMH, NIH).


Name: NIH_MGC_181
Library ID: 2026
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: White matter
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.42 kb. Library was constructed by Invitrogen. Note: this is a NIH_MGC Library.


Name: NIH_MGC_19
Library ID: 1476
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: neuroblastoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_192
Library ID: 2050
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: glioblastoma cell line
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' SmaI/NotI 3'
Stop Codon Status: without
Description: The library was constructed by reverse transcription of 1 ug mRNA using the oligo dT primer GCGGCCGCCC(T)20 and an RNaseH + MMLV reverse transcriptase. Second strand synthesis was carried out by standard methods. The cDNA was size selected by agarose gel for > 1.2 kb, digested with Not I and directionally cloned into the vector Express-1 at the SmaI/NotI sites. DNA from the primary library was used for in vitro transcription from the T7 promoter to produce biotinylated RNA transcripts. These biotinylated transcripts, along with blocking oligos to the poly-A, multiple cloning site and primer regions, were hybridized with single stranded circles produced by phagmeid production from the primary library to a Cot value of 10-20. Strepavidin/phenol extraction was utilized to remove DNA:RNA hybrids leaving un-hybridized single stranded circles which were repaired by primer extension and transformed back into E. coli resulting in the normalized library. Average insert size 2.0 kb. 3' linker/adaptor sequence GCGGCCGCCC(T)20. This libary was constructed by Agencourt Bioscience.


Name: NIH_MGC_227
Library ID: 2090
Organism: Homo sapiens
Gender: male
Age: 47
Stage: adult
Organ: brain/CNS
Tissue: Bulk tissue from Human Spinal cord
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned. 5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)30N-1N-3'. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected for >0.5kb with an average insert size of 1.3kb Library created in the laboratory of Jonathan Kuo and Ted Usdin. Note: this is a NIH_MGC Library


Name: NIH_MGC_228
Library ID: 2091
Organism: Homo sapiens
Gender: male
Age: 47
Stage: adult
Organ: brain/CNS
Tissue: cerebellar cortex
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned.5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)3N-1N-3. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected for >0.5kb with an average insert size of 1.2kb Library created in the laboratory of Jonathan Kuo and Ted Usdin.


Name: NIH_MGC_229
Library ID: 2092
Organism: Homo sapiens
Gender: male
Age: 47
Stage: adult
Organ: brain/CNS
Tissue: Human Brain - Frontal Cortex
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned.5' and 3' adaptors were used in cloning as follows: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTACGGCCGGG-3' 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-d(T)3N-1N-3. Full-length enriched library was constructed using the Clontech Creator SMART kit and size-selected for >0.5kb with an average insert size of 1.2kb Library created in the laboratory of Jonathan Kuo and Ted Usdin.


Name: NIH_MGC_264
Library ID: 2170
Organism: Homo sapiens
Gender: female
Age: 73
Stage: adult
Organ: brain/CNS
Tissue: normal brain
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_272 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_266
Library ID: 2172
Organism: Homo sapiens
Gender: both
Age: 0
Stage: fetal
Organ: brain/CNS
Tissue: normal brain, pool
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_274 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_272
Library ID: 2204
Organism: Homo sapiens
Gender: female
Age: 73
Stage: adult
Organ: brain/CNS
Tissue: normal brain
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_264 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_274
Library ID: 2206
Organism: Homo sapiens
Gender: both
Age: 0
Stage: fetal
Organ: brain/CNS
Tissue: normal brain, pool
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_266 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_286
Library ID: 2260
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: cerebral cortex
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_287 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_287
Library ID: 2261
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: cerebral cortex
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_286 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_288
Library ID: 2282
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: cerebral cortex
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_289 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_289
Library ID: 2283
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: cerebral cortex
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_288 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_306
Library ID: 2270
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: normal brain
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_307 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_307
Library ID: 2271
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: normal brain
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_306 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_308
Library ID: 2292
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: normal brain
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_309 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_309
Library ID: 2293
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: normal brain
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_308 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_310
Library ID: 2272
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: cerebellum
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_311 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_311
Library ID: 2273
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: cerebellum
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_310 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_312
Library ID: 2294
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: cerebellum
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_313 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_313
Library ID: 2295
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: cerebellum
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_312 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_47
Library ID: 1747
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: neuroblastoma, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_56
Library ID: 1584
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: primitive neuroectodermal cell line
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_57
Library ID: 1585
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: glioblastoma cell line
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.55 kb (range 0.9-4.0 kb). 12/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_73
Library ID: 1641
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: brain
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.35 kb (range 0.5-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_95
Library ID: 1698
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: hippocampus tissue
Host: DH10B
Vector: pBluescriptR
Vector type: phagemid
Insert digest: 5' SalI-XhoI/BamHI 3'
Stop Codon Status: without
Description: Oligo-dT primed using primer 5''-TTTTTTTTTTTTTTTTVN-3'', size-selected for average insert size 2.5 kb and normalized to ROT 5. This is a primary library enriched for full-length clones and constructed using the Cap-trapper method (Carninci, in preparation). Library constructed by M. Brownstein (NIMH/NHGRI, National Institutes of Health). Note: this is a NIH_MGC Library.


Name: NIH_MGC_96
Library ID: 1708
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: hypothalamus tissue
Host: DH10B
Vector: pBluescriptR
Vector type: phagemid
Insert digest: 5' SalI-XhoI/BamHI 3'
Stop Codon Status: without
Description: Oligo-dT primed using primer 5''-TTTTTTTTTTTTTTTTVN-3'', size-selected for average insert size 2.3 kb and normalized to ROT 5. This is a primary library enriched for full-length clones and constructed using the Cap-trapper method (Carninci, in preparation). Library constructed by M. Brownstein (NIMH/NHGRI, National Institutes of Health). Note: this is a NIH_MGC Library.


Name: NIH_MGC_98
Library ID: 1766
Organism: Homo sapiens
Age: 0
Organ: brain/CNS
Tissue: astrocytoma, grade IV, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.

Schiller astrocytoma

Name: Schiller astrocytoma
Library ID: 1278
Organism: Homo sapiens
Gender: male
Age: 44
Stage: adult
Organ: brain/CNS
Tissue: astrocytoma, determined by consensus pathology
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from human astrocytoma usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. Tumor identification by consensus pathology. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Schiller glioblastoma multiforme

Name: Schiller glioblastoma multiforme
Library ID: 1280
Organism: Homo sapiens
Gender: female
Age: 33
Stage: adult
Organ: brain/CNS
Tissue: glioblastoma multiforme, determined by consensus pathology. Tumor has LOH on chromosomes 10 and 14 and a gain in 9p and 1q. The tumor also has a heterozygous p53 mutation R273C.
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from human glioblastoma multiforme usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. Tumor identification by consensus pathology; shows LOH on chromosomes 10 and 14 and a gain in 9p and 1q. The tumor also has a heterozygous p53 mutation R273C. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Schiller meningioma

Name: Schiller meningioma
Library ID: 1279
Organism: Homo sapiens
Gender: female
Age: 72
Stage: adult
Organ: brain/CNS
Tissue: meningioma, determined by consensus pathology
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from human meningioma usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. Tumor identification by consensus pathology. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Schiller oligodendroglioma

Name: Schiller oligodendroglioma
Library ID: 1277
Organism: Homo sapiens
Gender: male
Age: 44
Stage: adult
Organ: brain/CNS
Tissue: oligodendroglioma, determined by consensus pathology and chromosome 1p and 19q deletion determined by CGH.
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from human oligodendroglioma usingprimer 5'-GAGAGAGAGAGAGAGAGAGAAACTAGTCTGAGT(18)-3'. An EcoRI adaptor was used on the 5' end of the cDNA as follows: 5'-AATTCGGCACGAG-3'. The library was size-selected and went through one round of amplification. Average insert size is 1.7 kb, with a range from 0.4-12 kb. Tumor identification by consensus pathology; contains chromosome 1p and 19q deletion as determined by CGH. This library was constructed by Dr. Martin Schiller (Johns Hopkins University).

Schneider fetal brain 00004

Name: Schneider fetal brain 00004
Library ID: 1341
Organism: Homo sapiens
Gender: male
Age: 0
Stage: fetal
Organ: brain/CNS
Tissue: frontal lobe
Host: DH10B
Vector: pBluescript SK+
Vector type: phagemid
Insert digest: 5' SstI/XhoI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from human fetal brain tissue. 5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-GAGAGAGAGAAGAGCTCAAGGATCCTTAATTAAATTAATCCCCCCCCCCCCC-3' and 3' adaptor sequence: 5'-GAGAGAGAGACTCGAGTTTTTTTTTTTTTTTTTT-3'. The library was size-selected for >0.5 kb inserts and has an average insert size estimated at 1.2 kb. This library was constructed using the CAP-trapper method for full-length enrichment and has not undergone amplification. Library was constructed by Dr. Claudio Schneider (LNCIB-Area Science Park, Trieste, Italy).

Soares 1NIB

Name: Soares 1NIB
Library ID: 52
Organism: Homo sapiens
Gender: female
Age: 0
Stage: infant
Organ: brain/CNS
Tissue: whole brain
Host: DH10B
Vector: Lafmid BA
Vector type: phagemid
Insert digest: 5' HindIII/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' AACTGGAAGAATTCGCGGCCGCAGGAATTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Hind III adaptors (Pharmacia), digested with Not I and directionally cloned into the Not I and Hind III sites of the Lafmid BA vector. Library went through one round of normalization. Reference: PNAS 91, 9228-9232 (1994) Library constructed by Bento Soares and M. Fatima Bonaldo.

Soares 2NbHMSP

Name: Soares 2NbHMSP
Library ID: 201
Organism: Homo sapiens
Gender: male
Age: 46
Stage: adult
Organ: brain/CNS
Tissue: multiple sclerosis plaque
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA (prepared from RNA from 4 multiple sclerosis lesions from one patient, provided by Dr. K.G. Becker, NINDS/NIH) was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot5. Library constructed by Bento Soares and M. Fatima Bonaldo.

Soares N2b4HB55Y

Name: Soares N2b4HB55Y
Library ID: 83
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: whole brain
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot50, and contains inserts larger than 1.5 kb. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

Soares N2b5HB55Y

Name: Soares N2b5HB55Y
Library ID: 84
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: whole brain
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot50, and contains inserts ranging from 0.5 to 1.5 kb. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

Soares NbHFB

Name: Soares NbHFB
Library ID: 423
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: brain/CNS
Tissue: whole brain
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' AACTGGAAGAATTCGCGGCCGCAATATTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.

Stanley Frontal B/N pool 1

Name: Stanley Frontal B/N pool 1
Library ID: 1252
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: frontal cortex pool: S-136 (35 yo female), S-65 (48 yo male), S-75 (bipolar 34 yo male), S-83 (biplolar 48 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two male bipolars, ages 34 and 48 (S-75, S-83) subtracted by pool of two mentally normal individuals, male, age 48 and female, age 35 (S-65, S-136). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Frontal B/N pool 2

Name: Stanley Frontal B/N pool 2
Library ID: 1255
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: frontal cortex pool: S-111 (bipolar 45 yo male), S-124 (41 yo male), S-128 (bipolar 50 yo male), S-141 (53 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two bipolar males, ages 45 and 50 (S-111, S-128) subtracted by pool of two mentally normal males, ages 41 and 53 (S-124, S-141). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Frontal N/B pool 2

Name: Stanley Frontal N/B pool 2
Library ID: 1256
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: frontal cortex pool: S-111 (bipolar 45 yo male), S-124 (41 yo male), S-128 (bipolar 50 yo male), S-141 (53 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two mentally normal males, ages 41 and 53 (S-124, S-141) subtracted by pool of two bipolar males, ages 45 and 50 (S-111, S-128). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Frontal N/S pool 2

Name: Stanley Frontal N/S pool 2
Library ID: 1254
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: frontal cortex pool: schizophrenic 44 yo male, S-118 (56 yo female), S-124 (41 yo male), S-141 (53 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two mentally normal male individuals ages 41 and 53 (S-124, S-141) subtracted by pool of two schizophrenic individuals, male age 44 and female age 56 (S-116, S-118). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Frontal S/B pool 1

Name: Stanley Frontal S/B pool 1
Library ID: 1251
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: frontal cortex pool: S-121 (schizophrenic 32 yo male), S-30 (schizophrenic 30 yo male), S-75 (bipolar 34 yo male), S-83 (bipolar 48 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two male schizophrenics, ages 30 and 32 (S-30, S-121) subtracted by pool of two male bipolars, age 34 and 48 (S-75, S-83). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Frontal S/N individual

Name: Stanley Frontal S/N individual
Library ID: 1249
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: pool of 2 frontal cortexes: S-11 (schizophrenic 34 yo male), S-37 (28 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. 34 yo schizophrenic male (S-11) subtracted by 28 yo mentally normal male (S-37). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Frontal S/N pool 1

Name: Stanley Frontal S/N pool 1
Library ID: 1250
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: frontal cortex pool: S-121 (schizophrenic 32 yo male), S-136 (35 yo female), S-30 (schizophrenic 30 yo male), S-65 (48 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two male schizophrenics, ages 30 and 32 (S-30, S-121) subtracted by pool of two mentally normal individuals, male, age 48 and female, age 35 (S-65, S-136). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Frontal S/N pool 2

Name: Stanley Frontal S/N pool 2
Library ID: 1253
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: frontal cortex pool: schizophrenic 44 yo male, S-118 (schizophrenic 56 yo female), S-124 (41 yo male), S-141 (53 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of two schizophrenics, male age 44 and female age 56 (S-116, S-118) subtracted by pool of two mentally normal male individuals ages 41 and 53 (S-124, S-141). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Hippocampus B/N pool 1

Name: Stanley Hippocampus B/N pool 1
Library ID: 1259
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: hippocampus pool: S-128 (bipolar 50 yo male), S-164 (50 yo female), S-47 (bipolar 37 yo female), S-65 (48 yo male), S-67 (34 yo male), S-83 (bipolar 48 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three bipolar individuals, male, ages 48 and 50, female, age 37 (S-47, S-83, S-128) subtracted by pool of three mentally normal individuals, male, ages 34 and 48, female, age 50 (S-65, S-67, S-164). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Hippocampus B/S pool 1

Name: Stanley Hippocampus B/S pool 1
Library ID: 1262
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: hippocampus pool: S-109 (schizophrenic 60 yo male), S-11 (schizophrenic 34 yo male), S-128 (bipolar 50 yo male), S-47 (bipolar 37 yo female), S-64 (schizophrenic 58 yo male), S-83 (biploar 48 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three bipolar individuals, male, ages 48 and 50, female, age 37 (S-47, S-83, S-128) subtracted by pool of three schizophrenic males, ages 34, 58 and 60 (S-11, S-64, S-109). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Hippocampus N/B pool 1

Name: Stanley Hippocampus N/B pool 1
Library ID: 1260
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: hippocampus pool: S-128 (bipolar 50 yo male), S-164 (50 yo female), S-47 (bipolar 37 yo female), S-65 (48 yo male), S-67 (34 yo male), S-83 (bipolar 48 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three mentally normal individuals, male, ages 34 and 48, female, age 50 (S-65, S-67, S-164) subtracted by pool of three bipolar individuals, male, ages 48 and 50, female, age 37 (S-47, S-83, S-128). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Hippocampus N/S pool 1

Name: Stanley Hippocampus N/S pool 1
Library ID: 1258
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: hippocampus pool: S-109 (schizophrenic 60 yo male), S-11 (schizophrenic 34 yo male), S-164 (50 yo female), S-64 (schizophrenic 58 yo male), S-65 (48 yo male), S-67 (34 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three mentally normal individuals, male, ages 34 and 48, female, age 50 (S-65, S-67, S-164) subtracted by pool of three schizophrenic males, ages 34, 58 and 60 (S-11, S-64, S-109). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Hippocampus S/B pool 1

Name: Stanley Hippocampus S/B pool 1
Library ID: 1261
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: hippocampus pool: S-109 (schizophrenic 60 yo male), S-11 (schizophrenic 34 yo male), S-128 (bipolar 50 yo male), S-47 (bipolar 37 yo female), S-64 (schizophrenic 58 yo male), S-83 (bipolar 48 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three schizophrenic males, ages 34, 58 and 60 (S-11, S-64, S-109) subtracted by pool of three bipolar individuals, male, ages 48 and 50, female, age 37 (S-47, S-83, S-128). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stanley Hippocampus S/N pool 1

Name: Stanley Hippocampus S/N pool 1
Library ID: 1257
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: hippocampus pool: S-109 (schizophrenic 60 yo male), S-11 (schizophrenic 34 yo male), S-164 (50 yo female), S-64 (schizophrenic 58 yo male), S-65 (48 yo male), S-67 (34 yo male)
Host: GeneHogs DH10B
Vector: pCR2.1-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Total RNA (purified with Trizol and DNAsed before use) was reverse transcribed using a modified oligo-dT primer containing RsaI and HindIII sites. Double- stranded cDNA was digested with RsaI, resulting in blunt ended cDNA of an average 0.1-2 kb in length. Digested cDNA was split into two sets, one used as is as the driver, the other set was split in half again and each half linked to a different adaptor (5'-TCGAGCGGCCGCCCGGGCAGGT-3' or 5'- AGGGCGTGGTGCGGAGGGCGGT-3'), to be used as tester. Subtraction was performed using the Clontech PCR Select cDNA subtraction kit. Pool of three schizophrenic males, ages 34, 58 and 60 (S-11, S-64, S-109) subtracted by pool of three mentally normal individuals, male, ages 34 and 48, female, age 50 (S-65, S-67, S-164). Tissues were obtained from the Stanley Neuropathology Consortium ( Library constructed and subtracted by Dr. Nancy Johnston [(410) 614-3918,].

Stratagene fetal brain (937226)

Name: Stratagene fetal brain (937226)
Library ID: 64
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: brain/CNS
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without

Stratagene mature hNT (937233)

Name: Stratagene mature hNT (937233)
Library ID: 280
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: differentiated, post-mitotic hNT neurons
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Differentiated, post mitotic hNT neurons. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Stratagene NT2 neuroepithelium (937230)

Name: Stratagene NT2 neuroepithelium (937230)
Library ID: 278
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: uninduced, exponentially growing neuroepithelial cells (Ntera-2/cl.D1)
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Uninduced, exponentially growing neuroepithelial cells (Ntera-2/c1.D1). Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Stratagene NT2/RA neuroepithelium 937231

Name: Stratagene NT2/RA neuroepithelium 937231
Library ID: 279
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: NT2 cells induced with retinoic acid for 24 hours
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. NT2 cells (Ntera-2/c1.D1) induced with Retinoic Acid for 24 hours. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Stratagene NT2/RA+MI neuroepith (937234)

Name: Stratagene NT2/RA+MI neuroepith (937234)
Library ID: 281
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: brain/CNS
Tissue: NT2 precursor cells induced with retinoic acid for 1 week, followed by 3 weeks in mitotic inhibitors
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. NT2 (Ntera-2/c1.D1) precursor cells induced with Retinoic Acid for 1 week, followed by 3 weeks in mitotic inhibitors (Replate #2). Average insert size: 1.1 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Stratagene schizophrenic brain S11

Name: Stratagene schizophrenic brain S11
Library ID: 380
Organism: Homo sapiens
Gender: male
Age: 34
Stage: adult
Organ: brain/CNS
Tissue: frontal cortex, schizophrenic
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: EcoRI
Stop Codon Status: without
Description: Random + oligo-dT primed into EcoRI site of ZAP II Vector. Mass excised. Avg insert length 1.4kb. Non-directionally cloned. Custom library provided by Dr. Nancy Johnston [(410) 614-3918,].


Name: NCI_CGAP_Br1
Library ID: 486
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: ductal epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: average insert size 600 bp, all ribosomal sequences- DO NOT ARRAY


Name: NCI_CGAP_Br1.1
Library ID: 501
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: pooled bulk tumor
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from pooled bulk breast tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAACCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is not normalized. (The normalized version of this library is NCI_CGAP_Br2.) Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br12
Library ID: 1245
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: invasive breast carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from breast carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Non-amplified library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br13
Library ID: 1288
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: breast carcinoma in situ
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from breast carcinoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br14
Library ID: 1289
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: normal breast epithelium
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from breast epithelium, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. CITATION: National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index CONT_NAME: Robert Strausberg, Ph.D. COMMENT: cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. cDNA Library Arrayed by: I.M.A.G.E. Consortium, LLNL Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br15
Library ID: 1300
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: adenocarcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from breast adenocarcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 400 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br16
Library ID: 1298
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: lobullar carcinoma in situ
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from breast carcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 400 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br17
Library ID: 1299
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: adenocarcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from breast adenocarcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 400 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br18
Library ID: 1355
Organism: Homo sapiens
Gender: female
Age: 0
Organ: breast
Tissue: pool of 3 high-grade tumors: 1 primary, 2 metatstatic to ovary
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Library constructed by Life Technologies, catalog #12006-011. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br2
Library ID: 502
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: pooled bulk tumor
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from pooled bulk breast tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAACCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. This library is the normalized version of NCI_CGAP_Br1.1. Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br21
Library ID: 1465
Organism: Homo sapiens
Gender: female
Age: 0
Organ: breast
Tissue: infiltrating carcinoma
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without


Name: NCI_CGAP_Br22
Library ID: 1570
Organism: Homo sapiens
Gender: female
Age: 0
Organ: breast
Tissue: invasive ductal carcinoma, 3 pooled samples
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.5 kb. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br3
Library ID: 534
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: ductal tumor
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Ductal breast tumor. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 0.9 kb.


Name: NCI_CGAP_Br4
Library ID: 590
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: ductal tissue
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal breast ductal tissue, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br5
Library ID: 591
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Tissue: infiltrating ductal carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from infiltrating ductal carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Br7
Library ID: 732
Organism: Homo sapiens
Age: 0
Organ: breast
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. Life Technologies catalog #:10985-018 Note: this is a NCI_CGAP Library.


Name: NIH_MGC_107
Library ID: 1859
Organism: Homo sapiens
Age: 0
Organ: breast
Tissue: adenocarcinoma, cell line
Host: DH10B TonA
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_151
Library ID: 2112
Organism: Homo sapiens
Age: 0
Organ: breast
Tissue: cancer cells growing in a xenograft mouse model
Host: DH10B
Vector: pOTB7-3
Vector type: phagemid
Insert digest: 5' AscI/BstXI 3'
Stop Codon Status: without
Description: Cells were isolated by flow cytometry and RNA isolated in Trizol reagent. cDNA was obtained by reverse transcription using oligo-dT primer 5'-GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTTTV-3'and treated with ExoI. PCR was performed using a complementary 3' primer containing a BstXI site and a cap-switch 5' primer. The resulting cDNA was digested with BstXI and ligated to a BstXI adaptor 5'-AAAAAAAAAAAAAAAAGTCGACATCGATACGCGTGGTCTCGTAGCTGACTTTCCAGCACA-3' then digested with AscI. Size-selection was performed >0.5 kb to result in an average insert size of 0.8 kb. Library constructed and contributed by Mike Clarke and Andrew Hass (University of Michigan). Note: this is an MGC library.


Name: NIH_MGC_159
Library ID: 2011
Organism: Homo sapiens
Age: 0
Organ: breast
Tissue: infiltrating ductal carcinoma
Host: DH10B TonA
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5' adaptor: GGCACGAG(G). Library constructed by Genome Therapeutics Corp. Tissue contributed by Narayan K. Bhat using ZAP-cDNA synthesis kit (Stratagene).


Name: NIH_MGC_87
Library ID: 1713
Organism: Homo sapiens
Gender: female
Age: 0
Organ: breast
Tissue: mammary adenocarcinoma, cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.383 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.

Soares 2NbHBst

Name: Soares 2NbHBst
Library ID: 78
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization to Cot230. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

Soares 3NbHBst

Name: Soares 3NbHBst
Library ID: 79
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: breast
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization to Cot20. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).


Name: NCI_CGAP_Car1
Library ID: 1912
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: osteoarthritic cartilage from knee
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCTGATCACGCTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2074
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: cartilage, osteoarthritic
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTGATCACGCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_EU1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2075
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: cartilage, osteoarthritic
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTGATCACGCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_EU0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2076
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: chondrosarcoma, grade II
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCATCTAATATGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_EZ1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2077
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: chondrosarcoma, grade II
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCATCTAATATGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_EZ0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2078
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: chondrosarcoma, grade II, pool of 3
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGCTACGGACTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FE1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2079
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: chondrosarcoma, grade II, pool of 3
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCGCTACGGACTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_FE0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2082
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: chondrosarcoma, grade I
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAGAATCCGGCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FH1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2083
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: chondrosarcoma, grade I
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAGAATCCGGCTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_FH0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2084
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: chondrosarcoma, grade III, pool of 4
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGAGGTCGGTGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_FL1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2085
Organism: Homo sapiens
Age: 0
Organ: cartilage
Tissue: chondrosarcoma, grade III, pool of 4
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGAGGTCGGTGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version of this library is also available, NCI_CGAP_FL0). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

Clontech HeLa S3 cells (HL3021s)

Name: Clontech HeLa S3 cells (HL3021s)
Library ID: 75
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: cervix
Tissue: HeLa S3 cells
Host: MC1061/P3
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' BstXI/NotI 3'
Stop Codon Status: without


Name: NIH_MGC_12
Library ID: 1421
Organism: Homo sapiens
Gender: female
Age: 0
Organ: cervix
Tissue: carcinoma cell line
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.5 kb. Library prepared by Life Technologies. Note: this is a NIH_MGC Library.


Name: NIH_MGC_13
Library ID: 1564
Organism: Homo sapiens
Gender: female
Age: 0
Organ: cervix
Tissue: carcinoma cell line
Host: GeneHogs DH10B
Vector: pDNR-NCI
Vector type: phagemid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA.
5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence:
5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence:
5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.7-3.7 kb).
This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA).
Note: this is a NIH_MGC Library.


Name: NIH_MGC_35
Library ID: 1409
Organism: Homo sapiens
Gender: female
Age: 0
Organ: cervix
Tissue: carcinoma cell line
Host: GeneHogs DH10B
Vector: pOTB7a
Vector type: plasmid
Insert digest: 5' CeuI/SceI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 1.8kb. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library.


Name: NIH_MGC_4
Library ID: 1420
Organism: Homo sapiens
Gender: female
Age: 0
Organ: cervix
Tissue: cervix carcinoma cell line
Host: GeneHogs DH10B
Vector: pOTB7a
Vector type: plasmid
Insert digest: 5' CeuI/SceI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 900 bp. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library.


Name: NIH_MGC_5
Library ID: 1424
Organism: Homo sapiens
Gender: female
Age: 0
Organ: cervix
Tissue: cervix carcinoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_64
Library ID: 1530
Organism: Homo sapiens
Gender: female
Age: 0
Organ: cervix
Tissue: carcinoma cell line
Host: GeneHogs DH10B
Vector: pOTB7a
Vector type: plasmid
Insert digest: 5' CeuI/SceI 3'
Stop Codon Status: without
Description: This library is a size selection of NIH_MGC_35, from 3.0-4.5 kb. Size selection done at the National Institute of Mental Health, NIH. Note: this is a NIH_MGC Library.

Soares NHCe

Name: Soares NHCe
Library ID: 1383
Organism: Homo sapiens
Gender: female
Age: 0
Organ: cervix
Tissue: normal cervix
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGGGCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized; constructed by Bento Soares and M.Fatima Bonaldo.

Soares NHCeC

Name: Soares NHCeC
Library ID: 1384
Organism: Homo sapiens
Gender: female
Age: 0
Organ: cervix
Tissue: cervical tumor
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGAAGTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized; constructed by Bento Soares and M.Fatima Bonaldo.

Stratagene HeLa S3 cells (937216)

Name: Stratagene HeLa S3 cells (937216)
Library ID: 272
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: cervix
Tissue: HeLa S3 epithelioid carcinoma cells grown to semi-confluency with no induction
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. HeLa S3 epithelioid carcinoma cells grown to semi-confluency without induction. Average insert size: 1.5 kb; Uni-ZAP XR Vector. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Morton fetal cochlea

Name: Morton fetal cochlea
Library ID: 190
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: cochlea
Tissue: pooled
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Fetal cochlea, normal. 37% of inserts <0.5kb, 56% 0.5-1.0kb, 7% >1kb. Uni-ZAP XR Vector. Library constructed by N. Robertson, C. Morton. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Reference: Genomics 23, 42-50 (1994)

Barstead HPL-RB7

Name: Barstead HPL-RB7
Library ID: 1311
Organism: Homo sapiens
Gender: male
Age: 25
Stage: adult
Organ: colon
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCACTAGTAAT 3' and 5' ATTACTAGTG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).


Name: NCI_CGAP_Co1
Library ID: 406
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: bulk tumor
Host: DH10B
Vector: pCMV-SPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co10
Library ID: 527
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: tumor RER+
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from RER+ colon tumor, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAACGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Non-normalized version of this library is named NCI_CGAP_Co9. Library was constructed by Bento Soares and M. Fatima Bonaldo (N-Soares4). Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co11
Library ID: 532
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: pooled tumors
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Multiple colon tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.1 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co12
Library ID: 543
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: pooled tumors
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pooled colon tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.2 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co14
Library ID: 1240
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: moderately differentiated adenocarcinoma
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.7 kb. Life Technologies catalog #: 11531-019 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co16
Library ID: 1296
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: tumor RER+
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Plasmid DNA from the normalized library NCI_CGAP_Co10 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 1057416-1061255, and 1144584-1145351). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co17
Library ID: 1359
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: juvenile granulosa tumor
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.9 kb. Library constructed by Life Technologies, catalog #11999-018. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co18
Library ID: 1371
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: moderately differentiated adenocarcinoma
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.26 kb. Library constructed by Life Technologies. Normalized versions of this library named NCI_CGAP_Co19 (Cot 50), NCI_CGAP_Co20 (Cot 500), and NCI_CGAP_Co21 (Cot >500). Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co19
Library ID: 1372
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: moderately differentiated adenocarcinoma
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Normalized to Cot50. Average insert size 1.32kb. Normalized version of NCI_CGAP_Co18. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co2
Library ID: 428
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: bulk villous adenoma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Bulk colon villous adenoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.1 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co20
Library ID: 1373
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: moderately differentiated adenocarcinoma
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Normalized to Cot 500. Average insert size 1.11kb. Normalized version of NCI_CGAP_Co18. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co21
Library ID: 1374
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: moderately differentiated adenocarcinoma
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Normalized to Cot >500. Average insert size 1.04kb. Normalized version of NCI_CGAP_Co18. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co22
Library ID: 1386
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: colonic adenocarcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co23
Library ID: 1462
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: colonic adenocarcinoma metastasis
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from colonic metastasis, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co25
Library ID: 1603
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: adenocarcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from colonic adenocarcinoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co26
Library ID: 1688
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: normal colonic mucosa
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal colonic mucosa, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co27
Library ID: 1691
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: adenocarcinoma (mucinous component)
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from colonic adenocarcinoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co28
Library ID: 1690
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: normal colonic mucosa
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from colonic mucosa, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co29
Library ID: 1692
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: tubulovillous adenoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from colonic adenoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co3
Library ID: 424
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: 12 pooled bulk tumors
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from 12 pooled bulk tumor samples andprimed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCTTCGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co4
Library ID: 505
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: colon
Tissue: tumor, 2 pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from pooled colon tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCCTTCGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. This library is not normalized. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co8
Library ID: 723
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: adenomcarcinoma
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from colon adenomcarcinoma, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGAATGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Co9
Library ID: 526
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: tumor RER+
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from RER+ colon tumor, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAACGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is not normalized. Normalized version of this library is named NCI_CGAP_Co10. Library was constructed by Bento Soares and M. Fatima Bonaldo (Soares4). Note: this is a NCI_CGAP Library.


Name: NIH_MGC_15
Library ID: 1428
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: colon adenocarcinoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_268
Library ID: 2174
Organism: Homo sapiens
Gender: male
Age: 51
Stage: adult
Organ: colon
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_276 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_276
Library ID: 2208
Organism: Homo sapiens
Gender: male
Age: 51
Stage: adult
Organ: colon
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_268 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_294
Library ID: 2264
Organism: Homo sapiens
Age: 0
Organ: colon
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_295 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_295
Library ID: 2265
Organism: Homo sapiens
Age: 0
Organ: colon
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_294 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_296
Library ID: 2286
Organism: Homo sapiens
Age: 0
Organ: colon
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_297 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_297
Library ID: 2287
Organism: Homo sapiens
Age: 0
Organ: colon
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_296 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_65
Library ID: 1614
Organism: Homo sapiens
Age: 0
Organ: colon
Tissue: adenocarcinoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library.

Soares/Dieckgraefe NHCD

Name: Soares/Dieckgraefe NHCD
Library ID: 1336
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: colonic mucosa isolated from patients with moderate to severe Crohn's disease; including perforating (fistulas)and non-perforating samples.
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGTCTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Tissue samples provided by Dr. Brian Dieckgraefe (Washington University,; colonic mucosa represents a range of disease involvement from moderate to severe Crohn's disease; samples include both perforating (fistulas) and non-perforating samples. Library constructed by Bento Soares and M. Fatima Bonaldo.

Soares/Dieckgraefe NHUC

Name: Soares/Dieckgraefe NHUC
Library ID: 1335
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: 5 ulcerative colitis patients - colonic mucosa representing different stages of disease from mild cryptitis to severe ulceration, fibrosis and degeneration.
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCTAGCTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Tissue samples provided by Dr. Brian Dieckgraefe (Washington University,; colonic mucosa represents a range of disease involvement from mild cryptitis to severe ulceration, fibrosis, and degeneration. Library constructed by Bento Soares and M. Fatima Bonaldo.

Stratagene colon tumor (937204)

Name: Stratagene colon tumor (937204)
Library ID: 268
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: T84 carcinoma cell line
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. From carcinoma cell line T84. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Stratagene colon tumor (937221)

Name: Stratagene colon tumor (937221)
Library ID: 275
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: colon
Tissue: HT-29 (HTB 38) adenocarcinoma, moderately differentiated grade II
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. From adenocarcinoma HT-29 (HTB 38), moderately differentiated grade II. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'


Name: NCI_CGAP_Sar4
Library ID: 1357
Organism: Homo sapiens
Age: 0
Organ: connective tissue
Tissue: pool of 5 tumors: myxoid liposarcoma, solitary fibrous tumor (sarcoma), malignant fibrous histiocytoma, gastrointestinal stromal tumor, mesothelioma
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.6 kb. Library constructed by Life Technologies, catalog #12004-016. Note: this is a NCI_CGAP Library.

NIA Human H1 Embryonic Stem Cells cDNA Library (Long)

Name: NIA Human H1 Embryonic Stem Cells cDNA Library (Long)
Library ID: 2045
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: undifferentiated ES cell line H1
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This is a long-transcript enriched cDNA library (Ref. Genome Res. 11: 1553-1558 (2001). [PMID: 11544199]). Undifferentiated human ES cell line H1 was obtained from WiCell Research Institute, Inc., Madison, Wi, cultured according to their instructions, and prepared for RNA extraction by Drs. Drs. Irene Ginis and Mahendra S. Rao. Briefly, cells were cultured on mouse embryonic fibroblast (MEF) feeders in ES cell medium consisting of DMEM/F12 (Invitrogen/GIBCO 11330-032) supplemented with 20% Knockout Serum Replacement, 100 mM MEM nonessential amino acids, 0.55 mM beta-mercaptoethanol, 2 mM L-glutamine, antibiotics/antimycotics, and with 4 ng/ml human basic fibroblast growth factor (bFGF) (all from Invitrogen/GIBCO). MEF derived from E12.5 mouse embryo were purchased from StemCell Technologiea, Inc. Vancouver, Canada. MEF were expanded on 0.5% bovine gelatin-coated dishes in DMEM medium (cat#11965-092) supplemented with 10% FBS (heat inactivated, Hyclone cat#3007103), 2 mM glutamine and 100 mM MEM non-essential amino acids. Subconfluent MEF cultures were treated with 1 mg/ml Mitomycin C (Sigma) for 3 hours to arrest cell division, trypsinized and plated at 0.2x105/cm2 onto 5% bovine collagen-coated dishes overnight. Feeders were washed twice with PBS; and then incubated in ES cell medium for at least 1 hour before plating ES cells. MEF''s of passage 2-3 were used as feeders. ES cells plated on top of MEF feeders were cultured at 5% CO2/5% O2 humidified tissue culture incubator from Thermo Forma. They formed round colonies with defined edges and were positive for alkaline phosphatase and SSEA-4. When confluent (18-10 days after plating) ES cells were treated with 1 mg/ml collagenase, type IV (Invitrogen/GIBCO) for 5-10 min and gently scraped off with 5 ml pipette. Cells from 4X6cm dishes were spun at 500 rpm for 3 min and the pellet was used for RNA purification. RNA was purified with TRIzol Reagent from Invitrogen. Double-stranded cDNAs were synthesized with an Oligo(dT) primer [Invitrogen: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3''] from 3.45g of total RNA, treated with T4 DNA polymerase, and purified by ethanol- precipitation. The cDNAs were ligated to Lone-linker LL-Sal4, purified by phenol/chloroform extraction, and separated from free linkers by Centricon-100 column. Then, the cDNAs were amplified by long-range high fidelity PCR using Ex Taq polymerase (Takara) with a primer Sal4-S. The products were purified by phenol/chloroform extraction and Centricon-100 column. The cDNAs were digested with SalI and NotI enzymes and cloned into SalI/NotI site of pCMV- SPORT6 plasmid vector. The DH10B E. coli host was transformed with the ligation mixture by the standard chemical method. The average insert size is about 3.6kb. The library was constructed by Yulan Piao. Note: this is a NIH_MGC Library.


Name: NIH_MGC_172
Library ID: 2032
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic Stem Cells H1
Host: DH10B TonA
Vector: pDONR201
Vector type: plasmid
Insert digest: 5' attP2/attP1
Stop Codon Status: without
Description: cDNA made by oligo-dT with attB2 site and directionally cloned. Priming sequence: 5'-TTTCCTGCAGGCCGGCCACCACTTTGTACAAGAAAGCTGGGTTTTTTTTTTTTTTTTTTT-3'. Full-length enriched library was constructed using the GeneRacer kit by Invitrogen, library amplification 16 cycles. Library constucted by Mark Bittinger in the Bradfield laboratory (McArdle Laboratory for Cancer Research, University of Wisconsin). Note: this is a NIH_MGC Library.


Name: NIH_MGC_193
Library ID: 2046
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic Stem Cells HI
Host: DH10B TonA
Vector: pCI-neo (updated)
Vector type: plasmid
Insert digest: 5' AscI/PacI 3'
Stop Codon Status: without
Description: Constructed by Gina Zastrow using the Bradfield Laboratory RACE method (University of Wisconsin). Note: this is a NIH_MGC Library.


Name: NIH_MGC_200
Library ID: 2113
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: ES cell line BG01, undifferentiated
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed using primer 5'-AAGCAGTGGTATCAACGCAGAGTGGCCGAGGCGGCCT(30)-3' and directionally cloned using 5' adaptor sequence: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCrGrGrG-3' Average insert size 0.96 kb (range 0.4-2.5 kb). Library is normalized and enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Reference: Biotechniques 30:892-897 (2001). Note: this is a NIH_MGC Library.


Name: NIH_MGC_201
Library ID: 2114
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: ES cell line BG01, derived early primative ectodermal like (EPL) cells, the in vitro equivalent of the next pluripotent stage of development
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed using primer 5'-AAGCAGTGGTATCAACGCAGAGTGGCCGAGGCGGCCT(30)-3' and directionally cloned using 5' adaptor sequence: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCrGrGrG-3' Average insert size 1.04 kb (range 0.5-2.5 kb). Library is normalized and enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Reference: Biotechniques 30:892-897 (2001). Note: this is a NIH_MGC Library.


Name: NIH_MGC_202
Library ID: 2115
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: ES cell line BG01, derived embyoid bodies with high levels of neural progenitors
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed using primer 5'-AAGCAGTGGTATCAACGCAGAGTGGCCGAGGCGGCCT(30)-3' and directionally cloned using 5' adaptor sequence: 5'-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCrGrGrG-3' Average insert size 0.9 kb (range 0.4-2.5 kb). Library is normalized and enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Reference: Biotechniques 30:892-897 (2001). Note: this is a NIH_MGC Library.


Name: NIH_MGC_239
Library ID: 2095
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic stem cell, pooled H7 ES cell line, passage 22
Host: DH10B TonA
Vector: pCI-neo (updated)
Vector type: plasmid
Insert digest: 5' AscI/PacI 3'
Stop Codon Status: without
Description: Bradfield Lab RACE method. Size selection 500-2kb, average insert size 550bp


Name: NIH_MGC_240
Library ID: 2096
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic stem cells pooled from H7 ES cell line, passage 22
Host: DH10B TonA
Vector: pCI-neo (updated)
Vector type: plasmid
Insert digest: 5' AscI/PacI 3'
Stop Codon Status: without
Description: Bradfield Lab RACE method, Size selection 2kb-5kb, average insert size 550bp.


Name: NIH_MGC_258
Library ID: 2185
Organism: Homo sapiens
Gender: male
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic stem cells isolated from the inner cell mass of blastocyst stage embryos and differentiated to an early endodermal cell type. Markers: GATA4+, MixL1+, Msx1+, HNF4alpha+, AFP-, Passage number: 40
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without


Name: NIH_MGC_259
Library ID: 2186
Organism: Homo sapiens
Gender: male
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic stem cells isolated from the inner cell mass of blastocyst stage embryos and differentiated to an early endodermal cell type. Markers: GATA4+, MixL1+, Msx1+, HNF4alpha+, AFP-, Passage number: 40
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.2 kb resulted in an average insert size of 1.6 kb. This primary library is normalized to Cot10 (non-normalized primary library is NIH_MGC_258) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.


Name: NIH_MGC_260
Library ID: 2187
Organism: Homo sapiens
Gender: male
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic stem cells isolated from the inner cell mass of blastocyst stage embryos. Markers: SSEA1-, SSEA3+, SSEA4+, Tra 1-60+, Tra 1-81+, CD9+, Alk Phos+, Oct4+, Nanog+. Passage number: 21
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.9 kb. This primary library is not normalized (normalized primary library is NIH_MGC_261) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.


Name: NIH_MGC_261
Library ID: 2188
Organism: Homo sapiens
Gender: male
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic stem cells isolated from the inner cell mass of blastocyst stage embryos. Markers: SSEA1-, SSEA3+, SSEA4+, Tra 1-60+, Tra 1-81+, CD9+, Alk Phos+, Oct4+, Nanog+. Passage number: 21
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.5 kb. This primary library is normalized to Cot10 (non-normalized primary library is NIH_MGC_260) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.


Name: NIH_MGC_262
Library ID: 2189
Organism: Homo sapiens
Gender: male
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic Stem cells isolated from the inner cell mass of blastocyst stage embryos and differentiated to an early neural progenitor cell type. Markers: Nestin+, Musashi+-. Passage number: 18
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 2.1 kb. This primary library is not normalized (normalized primary library is NIH_MGC_263) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.


Name: NIH_MGC_263
Library ID: 2190
Organism: Homo sapiens
Gender: male
Age: 0
Stage: embryo
Organ: embryonic stem cell
Tissue: Embryonic Stem cells isolated from the inner cell mass of blastocyst stage embryos and differentiated to an early neural progenitor cell type. Markers: Nestin+, Musashi+-. Passage number: 18
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5''-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3'' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection >1.25 kb resulted in an average insert size of 1.6 kb. This primary library is normalized to Cot10 (non-normalized primary library is NIH_MGC_262) and was constructed by Express Genomics (Frederick, MD). Note: this is a NIH_MGC library.

Stratagene endothelial cell (937223)

Name: Stratagene endothelial cell (937223)
Library ID: 277
Organism: Homo sapiens
Age: 0
Stage: infant
Organ: endothelial cell
Tissue: umbilical vein endothelial cells, 1 passage
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Umbilical vein endothelial cells, passaged once. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'


Name: NCI_CGAP_Eso2
Library ID: 1243
Organism: Homo sapiens
Age: 0
Organ: esophagus
Tissue: squamous cell carcinoma
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Life Technologies catalog #: 11502-010 Note: this is a NCI_CGAP Library.


Name: NIH_MGC_16
Library ID: 1475
Organism: Homo sapiens
Age: 0
Organ: eye
Tissue: retinoblastoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_43
Library ID: 1679
Organism: Homo sapiens
Age: 0
Organ: eye
Tissue: normal pigmented retinal epithelium
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_67
Library ID: 1616
Organism: Homo sapiens
Age: 0
Organ: eye
Tissue: retinoblastoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.75 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library.

Soares N2b4HR

Name: Soares N2b4HR
Library ID: 85
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: eye
Tissue: retina
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCACTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot50, and has an average insert length of 2 kb. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

Soares N2b5HR

Name: Soares N2b5HR
Library ID: 86
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: eye
Tissue: retina
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCACTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot50, and has an average insert length of 1 kb. Library constructed by Bento Soares and M. Fatima Bonaldo (Columbia University).

Stratagene corneal stroma (937222)

Name: Stratagene corneal stroma (937222)
Library ID: 276
Organism: Homo sapiens
Age: 76
Stage: adult
Organ: eye
Tissue: corneal stroma grown out of explants
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Corneal fibroblasts grown out of explants from 76 year old donor. Average insert size: 1.5 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Stratagene fetal retina (937202)

Name: Stratagene fetal retina (937202)
Library ID: 267
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: eye
Tissue: pooled retinal tissue
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pooled retinal tissue. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Soares Nb2HF8-9w

Name: Soares Nb2HF8-9w
Library ID: 385
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: fetus
Tissue: total fetus
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from mRNA obtained from pooled 8-9 week (total) fetus material with a Not I - oligo(dT) primer [5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCTTAATTTTTTTTTTTTTTTTT-3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

Soares NbHSF

Name: Soares NbHSF
Library ID: 219
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: fibroblast
Tissue: senescent cells
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAACCATTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

Stratagene fibroblast (937212)

Name: Stratagene fibroblast (937212)
Library ID: 271
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: fibroblast
Tissue: WI-38 lung fibroblast cell line, grown to confluency
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. WI-38 lung fibroblast cell line grown to confluency. Average insert size: 0.8 kb; Uni-ZAP XR Vector. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'


Library ID: 1352
Organism: Homo sapiens
Age: 0
Organ: genitourinary
Tissue: high-grade transitional cell carcinoma, 2 pooled
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Library ID: 404
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: germ cell
Tissue: bulk seminoma
Host: DH10B
Vector: pCMV-SPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Note: this is a NCI_CGAP Library.


Library ID: 429
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: germ cell
Tissue: bulk tumor
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Bulk germ cell tumor. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.2 kb. Note: this is a NCI_CGAP Library.


Library ID: 633
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: germ cell
Tissue: 3 pooled tumors, including broad spectrum tumor types
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from 3 pooled germ cell tumors, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAATCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is not normalized. Normalized version of this library is named NCI_CGAP_GC4. Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Library ID: 634
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: germ cell
Tissue: 3 pooled tumors, including broad spectrum tumor types
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from 3 pooled germ cell tumors, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAATCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized. Non-normalized version of this library is named NCI_CGAP_GC3. Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Library ID: 533
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: germ cell
Tissue: pooled tumors
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Mixed germ cell tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 0.7 kb. Note: this is a NCI_CGAP Library.


Library ID: 1234
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: germ cell
Tissue: 3 pooled tumors, including broad spectrum tumor types
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Plasmid DNA from the normalized library NCI_CGAP_GC4 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 1257096-1258631, 1469064-1470983, and 1475592-1476743). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Library ID: 1328
Organism: Homo sapiens
Age: 0
Organ: gingiva
Tissue: normal gingiva -- cell line from primary keratinocytes
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. 5' adaptor sequence: 5' AATTCGGCACGAG 3' 3' GCCGTGCTC 5' 3' adaptor sequence: 5' (GA)10ACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3' EcoRI site appears to have been lost in a fraction of the clones. Library constructed by Stratagene; available through Mary May, PhD (Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, NIH; Note: this is a NCI_CGAP Library.


Library ID: 1329
Organism: Homo sapiens
Age: 0
Organ: gingiva
Tissue: normal gingiva -- cell line of immortalized keratinocytes
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. 5' adaptor sequence: 5' AATTCGGCACGAG 3' 3' GCCGTGCTC 5' 3' adaptor sequence: 5' (GA)10ACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3' EcoRI site appears to have been lost in a fraction of the clones. Library constructed by Stratagene; available through Mary May, PhD (Oral and Pharyngeal Cancer Branch, National Institute of Dental and Craniofacial Research, NIH; Note: this is a NCI_CGAP Library.


Name: NIH_MGC_182
Library ID: 2027
Organism: Homo sapiens
Age: 0
Organ: gut
Tissue: pooled gut (stomach, small intestine, colon, esophagus, gall bladder)
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.68. Library was constructed by Invitrogen. Note: this is a NIH_MGC Library.


Library ID: 1820
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: head/neck
Tissue: 1st pharyngeal arch, pooled samples
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-1.2 kb. Normalized to Cot10. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at


Library ID: 1876
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: head/neck
Tissue: mandible
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-2.0 kb. Normalized to Cot5. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at


Library ID: 1875
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: head/neck
Tissue: maxilla
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-1.8 kb. Normalized to Cot5. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at


Name: COGENE 8.5 EAT
Library ID: 1877
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: head/neck
Tissue: anterior tongue
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-1.6 kb. Normalized to Cot5. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at


Name: COGENE 8.5 EPT
Library ID: 1819
Organism: Homo sapiens
Age: 0
Stage: embryo
Organ: head/neck
Tissue: posterior tongue
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA primed using oligo-dT primer, directionally cloned into UDG sites of pAMP1. Size selected for insert sizes ranging from 0.2-2.5 kb. Normalized to Cot10. Primary library, non-amplified. Library constructed by M. Lovett. For more information on this library, please contact R. Tidwell (Washington University) or visit the COGENE website at


Library ID: 1604
Organism: Homo sapiens
Age: 0
Organ: head/neck
Tissue: normal
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from head/neck tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1605
Organism: Homo sapiens
Age: 0
Organ: head/neck
Tissue: nasopharyngeal carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from head/neck tumor, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 300 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_102
Library ID: 1767
Organism: Homo sapiens
Age: 0
Organ: head/neck
Tissue: salivary gland, epidermoid carcinoma, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.

Barstead HPL-RB3

Name: Barstead HPL-RB3
Library ID: 1059
Organism: Homo sapiens
Gender: male
Age: 64
Stage: adult
Organ: heart
Tissue: aorta
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGGATCCAAC 3' and 5' GTTGGATCCG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Barstead HPL-RB6

Name: Barstead HPL-RB6
Library ID: 1310
Organism: Homo sapiens
Gender: male
Age: 64
Stage: adult
Organ: heart
Tissue: aorta
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGGATCGAAC 3' and 5' GTTGGATCGG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Clontech heart (HL3026s)

Name: Clontech heart (HL3026s)
Library ID: 70
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: heart
Host: MC1061/P3
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' BstXI/NotI 3'
Stop Codon Status: without

Life Tech heart (10419-018)

Name: Life Tech heart (10419-018)
Library ID: 112
Organism: Homo sapiens
Gender: female
Age: 50
Stage: adult
Organ: heart
Host: DH12S
Vector: pCMV-SPORT
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: directionally cloned, average insert size 1.72 kb


Name: NIH_MGC_74
Library ID: 1642
Organism: Homo sapiens
Age: 0
Organ: heart
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.25 kb (range 0.6-4.0 kb). 14/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.

Soares NbHH19W

Name: Soares NbHH19W
Library ID: 227
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: heart
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATCTTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

Clontech kidney (HL3001s)

Name: Clontech kidney (HL3001s)
Library ID: 66
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: kidney
Host: MC1061/P3
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' BstXI/NotI 3'
Stop Codon Status: without

Gessler Wilms' tumor

Name: Gessler Wilms' tumor
Library ID: 440
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: kidney
Tissue: six pooled nephroblastomas; Wilms' tumor
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: RNA was prepared from a pool of anonymous Wilms' tumors by acid-phenol extraction. cDNA was synthesized with the Life Technologies Superscript plasmid system using an oligo dT-NotI primer for first strand synthesis. A SalI adaptor was ligated to the 5' ends of the clones. cDNA was size- selected on columns, NotI digested, and ligated into NotI/SalI-cut pSPORT1 and electroporated into DH10B cells. Average insert size: 2.0 kb. Library was constructed by Dr. Manfred Gessler.

Life Tech kidney (10420-016)

Name: Life Tech kidney (10420-016)
Library ID: 106
Organism: Homo sapiens
Gender: male
Age: 38
Stage: adult
Organ: kidney
Host: DH12S
Vector: pCMV-SPORT
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Caucasian. Average insert size: 1.32 kb; pCMV-SPORT vector.


Name: NCI_CGAP_Kid1
Library ID: 471
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: kidney
Tissue: papillary renal cell carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from invasive kidney tumor, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Kid11
Library ID: 1235
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: kidney
Tissue: 2 pooled
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Plasmid DNA from the normalized library NCI_CGAP_Kid3 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 1322376-1323911, 1456007-1456775, and 1500552-1502855). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Kid12
Library ID: 1309
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: kidney
Tissue: 2 pooled tumors, clear cell type
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Plasmid DNA from the normalized library NCI_CGAP_Kid5 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 1323912-1325831, 1471368-1472903 and 1492104-1493255). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Kid13
Library ID: 1351
Organism: Homo sapiens
Age: 0
Organ: kidney
Tissue: primary Wilms' tumor, Wilms' tumor metastatic to brain, pooled
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Kid3
Library ID: 687
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: kidney
Tissue: 2 pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' AACTGGAAGAATTCGCGGCCGCAATGCTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to Eco RI adaptors (Pharmacia), digested with Not I and cloned into the Not I and Eco RI sites of the modified pT7T3 vector. mRNA source: 2 pooled kidneys. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Kid5
Library ID: 688
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: kidney
Tissue: 2 pooled tumors, clear cell type
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' AACTGGAAGAATTCGCGGCCGCAATCTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Kid6
Library ID: 545
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: kidney
Tissue: pooled tumors
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pooled kidney tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.0 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Kid7
Library ID: 610
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: kidney
Tissue: 5 pooled tumors
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. 5 pooled kidney tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.3 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Kid8
Library ID: 1241
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: kidney
Tissue: renal cell cancer
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. Life Technologies catalog #: 11524-014 Note: this is a NCI_CGAP Library.


Name: NIH_MGC_108
Library ID: 1813
Organism: Homo sapiens
Age: 0
Organ: kidney
Tissue: Wilms' tumor
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_14
Library ID: 1427
Organism: Homo sapiens
Age: 0
Organ: kidney
Tissue: renal cell adenocarcinoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_45
Library ID: 1680
Organism: Homo sapiens
Age: 0
Organ: kidney
Tissue: renal carcinoma (ascites)
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_58
Library ID: 1586
Organism: Homo sapiens
Age: 0
Organ: kidney
Tissue: hypernephroma cell line
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.35 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_75
Library ID: 1656
Organism: Homo sapiens
Age: 0
Organ: kidney
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.5-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_80
Library ID: 1639
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: kidney
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from human fetal kidney tissue. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CATAGGATCCGTCGACCCCCCCC-3'' and 3'' adaptor sequence: 5''-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTTMN-3''. The library was size-selected and has an average insert size estimated at 2 kb. This library was constructed using the CAP-trapper method for full-length enrichment and has not undergone amplification. Library was constructed by Dr. Claudio Schneider (LNCIB-Area Science Park, Trieste, Italy). Note: this is a NIH_MGC Library.


Name: NIH_MGC_89
Library ID: 1725
Organism: Homo sapiens
Age: 0
Organ: kidney
Tissue: hypernephroma, cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.3 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.


Library ID: 763
Organism: Homo sapiens
Age: 0
Organ: larynx
Tissue: squamous cell carcinoma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' (GA)10ACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3' Library constructed by Stratagene. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lar1
Library ID: 546
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: larynx
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Larynx squamous carcinoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 0.9 kb. Note: this is a NCI_CGAP Library.

Life Tech leukocyte (10421-014)

Name: Life Tech leukocyte (10421-014)
Library ID: 107
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: leukocyte
Tissue: pooled
Host: DH12S
Vector: pCMV-SPORT
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size: 1.3 kb; pCMV-SPORT vector.


Name: NIH_MGC_118
Library ID: 1787
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: leukocyte
Tissue: leukocytes from non-activated multiple adult donors
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source leukocytes from anonymous pool of non-activated adult donors. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.7 kb, insert size range 1.2-3.3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 027. Note: this is a NIH_MGC Library.

Clontech fetal liver (HL3020s)

Name: Clontech fetal liver (HL3020s)
Library ID: 72
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: liver
Host: MC1061/P3
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' BstXI/NotI 3'
Stop Codon Status: without

Clontech liver (HL3006s)

Name: Clontech liver (HL3006s)
Library ID: 67
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: liver
Host: MC1061/P3
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' BstXI/NotI 3'
Stop Codon Status: without
Description: directionally cloned

Life Tech liver (10422-012)

Name: Life Tech liver (10422-012)
Library ID: 113
Organism: Homo sapiens
Gender: female
Age: 9
Stage: juvenile
Organ: liver
Host: DH12S
Vector: pCMV-SPORT
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: directionally cloned, average insert size 1.6 kb


Name: NCI_CGAP_Gas2
Library ID: 735
Organism: Homo sapiens
Age: 0
Organ: liver
Tissue: gastric carcinoma metastatic to liver
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Life Technologies catalog #: 10989-010 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Li1
Library ID: 476
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: liver
Tissue: hepatocytes
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal liver hepatocytes, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Li2
Library ID: 469
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: liver
Tissue: hepatocellular carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from invasive hepatocellular carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size- selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Li5
Library ID: 733
Organism: Homo sapiens
Age: 0
Organ: liver
Tissue: hepatic adenoma
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 0.8 kb. Life Technologies catalog #: 10986-016 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Li8
Library ID: 1405
Organism: Homo sapiens
Age: 0
Organ: liver
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr20
Library ID: 494
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: liver
Tissue: prostate tumor metastasis to liver
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from metastatic prostate lesion of the liver, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_100
Library ID: 1774
Organism: Homo sapiens
Age: 0
Organ: liver
Tissue: hepatocellular carcinoma, cell line
Host: DH10B TonA
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_290
Library ID: 2262
Organism: Homo sapiens
Age: 0
Organ: liver
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_291 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_291
Library ID: 2263
Organism: Homo sapiens
Age: 0
Organ: liver
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_290 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_292
Library ID: 2284
Organism: Homo sapiens
Age: 0
Organ: liver
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_293 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_293
Library ID: 2285
Organism: Homo sapiens
Age: 0
Organ: liver
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_292 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_76
Library ID: 1643
Organism: Homo sapiens
Age: 0
Organ: liver
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.85 kb (range 1.0-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_90
Library ID: 1726
Organism: Homo sapiens
Age: 0
Organ: liver
Tissue: adenocarcinoma, cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.7 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.

Stratagene liver (937224)

Name: Stratagene liver (937224)
Library ID: 63
Organism: Homo sapiens
Gender: male
Age: 49
Stage: adult
Organ: liver
Tissue: hepatectomy
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Hepatectomy from normal male caucasian. Average insert size: 1.1 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Clontech fetal lung (HL3022s)

Name: Clontech fetal lung (HL3022s)
Library ID: 68
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: lung
Host: MC1061/P3
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' BstXI/NotI 3'
Stop Codon Status: without
Description: directionally cloned

Clontech lung (HL3004s)

Name: Clontech lung (HL3004s)
Library ID: 71
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lung
Host: MC1061/P3
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' BstXI/NotI 3'
Stop Codon Status: without

Life Tech lung (10424-018)

Name: Life Tech lung (10424-018)
Library ID: 109
Organism: Homo sapiens
Gender: male
Age: 17
Stage: adult
Organ: lung
Host: DH12S
Vector: pCMV-SPORT
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: directionally cloned, average insert size 1.3 kb


Library ID: 1915
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lung
Tissue: metastatic chondrosarcoma, cell line VS-8
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGATCATTGCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DH1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 1916
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lung
Tissue: metastatic chondrosarcoma, cell line VS-8
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAGATCATTGCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_DH0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 1917
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lung
Tissue: focal fibrosis, pool
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCATACGCGGTCTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 1918
Organism: Homo sapiens
Age: 1
Stage: adult
Organ: lung
Tissue: metastatic chondrosarcoma
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAACTGTTCGGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version of this library is also available (NCI_CGAP_DT1). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 1919
Organism: Homo sapiens
Age: 1
Stage: adult
Organ: lung
Tissue: metastatic chondrosarcoma
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAACTGTTCGGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3'(Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (non-normalized version of the library is NCI_CGAP_DT0), and was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Name: NCI_CGAP_Lu1
Library ID: 427
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lung
Tissue: bulk tumor
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Bulk lung tumor. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.1 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu13
Library ID: 1339
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: adenocarcinoma, poorly differentiated
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGCCGGTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu19
Library ID: 1313
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: squamous cell carcinoma, poorly differentiated, 4 pooled tumors including primary and metastatic
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from pooled lung tumor tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGACAGCTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu21
Library ID: 1404
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: small cell carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu24
Library ID: 1312
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: neuroendocrine lung carcinoid
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Plasmid DNA from the normalized library NCI_CGAP_Lu5 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 1414920-1417991 and 1520904-1522439). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu25
Library ID: 1307
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lung
Tissue: bronchioalveloar carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from lung carcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu26
Library ID: 1308
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lung
Tissue: invasive carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from lung adenocarcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu27
Library ID: 1354
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: poorly-differentiated adenocarcinoma, 4 pooled
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies, catalog #12007-019. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu28
Library ID: 1353
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: squamous cell carcinoma, 2 pooled
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Library constructed by Life Technologies, catalog #12008-017. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu31
Library ID: 1375
Organism: Homo sapiens
Gender: male
Age: 0
Stage: fetal
Organ: lung
Tissue: lung, cell line
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally, no 5' adaptor. Primer: Oligo dT. Full-length library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu34
Library ID: 1392
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: large cell carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu34.1
Library ID: 1402
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: large cell carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu5
Library ID: 722
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: neuroendocrine lung carcinoid
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from neuroendocrine lung carcinoid, and was then primed with a Not I - oligo(dT) primer [5'-AACTGGAAGAATTCGCGGCCGCCAACTTTTTTTTTTTTTTTTTTT-3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized and was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu6
Library ID: 736
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: small cell carcinoma
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. Life Technologies catalog #: 10991-016 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lu7
Library ID: 737
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: adenocarcinoma
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Life Technologies catalog #: 10992-014 Note: this is a NCI_CGAP Library.


Name: NIH_MGC_101
Library ID: 1871
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: epidermoid carcinoma, cell line
Host: DH10B TonA
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_18
Library ID: 1651
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: large cell carcinoma, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_213
Library ID: 2106
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: pool of 3 metastases
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled lung metastases (cell lines) . The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCGATAAGGCCATTTTTTTTTTTTTTTTTT -3') contains the sequence tag GATAAGGCCA between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library constructed by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa). Note: this is a NIH_MGC Library.


Name: NIH_MGC_214
Library ID: 2107
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: pool of 3 metastases
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled lung metastases (cell lines) . The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCGATAAGGCCATTTTTTTTTTTTTTTTTT -3') contains the sequence tag GATAAGGCCA between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library constructed by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa). Note: this is a NIH_MGC Library.


Name: NIH_MGC_215
Library ID: 2108
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: pool of 3 metastases
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Non-normalized full-length enriched library from pooled lung metastases (cell lines) . The library was constructed in the pYX-Asc vector according to the procedure described in Genome Research 6:791-806. The oliogonucleotide used to prime first-strand synthesis (5'-TGTTACCATTCTGATGTTGGAGCGGCCGCGATAAGGCCATTTTTTTTTTTTTTTTTT -3') contains the sequence tag GATAAGGCCA between the NotI cloning site and dT(18) stretch. Cloning was accomplished via 5' and 3' adaptors as follows: 5'-GAATTCGGCACGAGG-3' and 5'-GCGGCCGCCAGCCACGAC-3'. Library constructed by Maria de Fatima Bonaldo and M. Bento Soares (University of Iowa). Note: this is a NIH_MGC Library.


Name: NIH_MGC_265
Library ID: 2171
Organism: Homo sapiens
Gender: female
Age: 61
Stage: adult
Organ: lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_273 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_273
Library ID: 2205
Organism: Homo sapiens
Gender: female
Age: 61
Stage: adult
Organ: lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_265 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_298
Library ID: 2266
Organism: Homo sapiens
Age: 0
Organ: lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_299 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_299
Library ID: 2267
Organism: Homo sapiens
Age: 0
Organ: lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_298 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_300
Library ID: 2288
Organism: Homo sapiens
Age: 0
Organ: lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_301 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_301
Library ID: 2289
Organism: Homo sapiens
Age: 0
Organ: lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_300 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_59
Library ID: 1587
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: mucoepidermoid carcinoma cell line
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_68
Library ID: 1617
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: large cell carcinoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library.


Name: NIH_MGC_69
Library ID: 1618
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: large cell carcinoma, undifferentiated, cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library.


Name: NIH_MGC_7
Library ID: 1408
Organism: Homo sapiens
Age: 0
Organ: lung
Tissue: small cell carcinoma, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_77
Library ID: 1657
Organism: Homo sapiens
Age: 0
Organ: lung
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.9 kb (range 0.5-4.0 kb). 12/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.

Soares NbHL19W

Name: Soares NbHL19W
Library ID: 216
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: lung
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAATTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

Stratagene lung (937210)

Name: Stratagene lung (937210)
Library ID: 60
Organism: Homo sapiens
Gender: male
Age: 72
Stage: adult
Organ: lung
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Normal lung. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Stratagene lung carcinoma (937218)

Name: Stratagene lung carcinoma (937218)
Library ID: 273
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lung
Tissue: small cell carcinoma cell line NCI-H69
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Small cell carcinoma cell line NCI-H69. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'


Name: NIH_MGC_3
Library ID: 1419
Organism: Homo sapiens
Age: 0
Organ: lymph
Tissue: lymph from Burkitt lymphoma, cell line
Host: GeneHogs DH10B
Vector: pOTB7a
Vector type: plasmid
Insert digest: 5' CeuI/SceI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into CeuI/SceI sites using the following 5'' adaptor: taactataacggtcctaaggtagcga and 3'' adaptor: tttcattacctctttctccgcaccccacataaa. Average insert size 840 bp. Library prepared by Edge BioSystems. Note: this is a NIH_MGC Library.


Name: NIH_MGC_36
Library ID: 1502
Organism: Homo sapiens
Age: 0
Organ: lymph
Tissue: germinal center B-cells mRNA size selected 1.35-2.37 kb
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library was derived from 1.35-2.37 kb mRNA size fraction;1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library.


Name: NIH_MGC_37
Library ID: 1503
Organism: Homo sapiens
Age: 0
Organ: lymph
Tissue: germinal center B cells mRNA size selected 0.5-1.35 kb
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library was derived from 0.5-1.35 kb mRNA size fraction;1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library.


Name: NIH_MGC_38
Library ID: 1504
Organism: Homo sapiens
Age: 0
Organ: lymph
Tissue: germinal center B cells mRNA size selected 2.37-3.5 kb
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library was derived from 2.37-3.5 kb mRNA size fraction;1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library.


Name: NIH_MGC_50
Library ID: 1507
Organism: Homo sapiens
Age: 0
Organ: lymph
Tissue: germinal center B-cells mRNA size selected 3.5-4.4 kb
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library was derived from 3.5-4.4 kb mRNA size fraction;1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library.


Name: NIH_MGC_51
Library ID: 1508
Organism: Homo sapiens
Age: 0
Organ: lymph
Tissue: germinal center B-cells mRNA size selected 4.4-7.4 kb
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library was derived from 4.4-7.4 kb mRNA size fraction;1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library.


Name: NIH_MGC_52
Library ID: 1509
Organism: Homo sapiens
Age: 0
Organ: lymph
Tissue: germinal center B-cells mRNA size selected 7.4-9.5 kb
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library was derived from 7.4-9.5 kb mRNA size fraction; 1st strand cDNA was primed with a Not I - oligo(dT) primer: 5''-TGTTACCAATCTGAAGTGGGAGCGGCCGCATATGACTTTTTTTTTTTTTTTTTTTTTTTTT-3''; double-stranded cDNA was ligated to EcoRI adaptors 5''-AATTCGGCACGAGG-3'' and 5''-CCTCGTGCCG-3'' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M.Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library.


Name: NIH_MGC_63
Library ID: 1527
Organism: Homo sapiens
Gender: male
Age: 19
Stage: adult
Organ: lymph
Tissue: cell line, T lymphoblast, acute lymphoblastic leukemia
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from lymphocyte cell line. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CATAGGATCCGTCGACCCCCCCC-3'' and 3'' adaptor sequence: 5''-GACTAGTTCTAGATCGCGAGCGGCCGCCCTTTTTTTTTTTTTTT-3''. This library was constructed using the CAP-trapper method for full-length enrichment and was constructed by Dr. Claudio Schneider (LNCIB-Area Science Park, Trieste, Italy). Note: this is a NIH_MGC Library.


Name: NIH_MGC_8
Library ID: 1425
Organism: Homo sapiens
Age: 0
Organ: lymph
Tissue: cell line, Burkitt lymphoma
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_85
Library ID: 1711
Organism: Homo sapiens
Age: 0
Organ: lymph
Tissue: lymphoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.867 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.


Name: NIH_MGC_99
Library ID: 1773
Organism: Homo sapiens
Age: 0
Organ: lymph
Tissue: lymph from lymphoma, cell line
Host: DH10B TonA
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Library ID: 762
Organism: Homo sapiens
Age: 0
Organ: lymph node
Tissue: metastatic squamous cell carcinoma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' (GA)10ACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3' Library constructed by Stratagene. Note: this is a NCI_CGAP Library.


Library ID: 1297
Organism: Homo sapiens
Age: 0
Organ: lymph node
Tissue: stem cell 34+/38+
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from bone marrow, stem cells 34+/38+, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 400 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lym12
Library ID: 1274
Organism: Homo sapiens
Age: 0
Organ: lymph node
Tissue: follicular mixed small and large cell
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.25 kb. Life Technologies catalog #: 11547-015 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lym3
Library ID: 594
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lymph node
Tissue: pooled lymphomas (10) including a broad spectrum of tumor types
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. 10 pooled lymphomas. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 0.9 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lym5
Library ID: 1246
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lymph node
Tissue: follicular lymphoma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. Non-amplified library. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Lym6
Library ID: 1247
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: lymph node
Tissue: mantle cell lymphoma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 0.8 kb. Non-amplified library. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'


Library ID: 2086
Organism: Homo sapiens
Age: 0
Organ: macrophage
Tissue: alveolar macrophage, pool of 81, challenged with different treatments
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGGCCATGCCGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. A normalized version (NCI_CGAP_FT1) and a subtracted version (NCI_CGAP_FT2) of this library are also available. Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2087
Organism: Homo sapiens
Age: 0
Organ: macrophage
Tissue: alveolar macrophage, pool of 81, challenged with different treatments
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGGCCATGCCGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized (a non-normalized version, NCI_CGAP_FT0, as well as a subtracted version, NCI_CGAP_FT2, of this library are also available). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.


Library ID: 2168
Organism: Homo sapiens
Age: 0
Organ: macrophage
Tissue: alveolar macrophage, pool of 81, challenged with different treatments
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer (5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCGGCCATGCCGTTTTTTTTTTTTTTTTTTTT-3'); double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is subtracted (a non-normalized version, NCI_CGAP_FT0, and normalized version, NCI_CGAP_FT1, of this library are also available). Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP library.

DFCI-Vidal horfeome 1.1

Name: DFCI-Vidal horfeome 1.1
Library ID: 2255
Organism: Homo sapiens
Age: 0
Organ: mixed
Host: DH10B TonA
Vector: pDONR223
Vector type: plasmid
Insert digest: 5' attB1.1/attB2.1 3'
Stop Codon Status: without
Description: Full open reading frame clones were created in the Gateway system by the M. Vidal laboratory (reference Genome Res. 2004 Oct;14(10B):2128-35) using MGC clones as templates. For PCR amplification, both forward and reverse ORF-specific primers for each MGC clone were designed automatically using the OSP program (Hillier and Green 1991). The forward primer starts from A of the ATG initiation codon, whereas the reverse primer starts from the second nucleotide of the termination codon. The reverse attB2.1 primers do not contain the last nucleotide of the termination codon, so as to allow generation of C-terminal fusion proteins. This library is specifically made of single colonies isolated at Lawrence Livermore National Laboratory from the transformed ORF pools. Clones were prepared by the M. Vidal laboratory (Dana Farber Cancer Institute) and generously donated for use by the NIH_MGC project.


Name: MAPcL
Library ID: 1980
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: Pooled cell lines
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRV (site destroyed upon cloning) and NotI. The library was size-selected and went through 26K fold of amplification. Average insert size is 1.8 kb. Library constructed from cell lines ZR-75-1, MCF7, SK-BR-3, MDA-MB-231, hTERT-HME1, LNCaP and subtracted against brain, liver, lung, kidney and muscle. cDNA Library constructed by Life Technologies (Invitrogen). The ZR-75-1, MCF7, SK-BR-3, MDA-MB-231, and LNCaP cell lines were acquired from ATCC. The hTERT-HME1 cell line was purchased from Clontech. REFERENCE: Kristi A. Egland, James J. Vincent, Robert Strausberg, Bungkook Lee, and Ira Pastan: Discovery of new breast cancer genes encoding membrane and secreted proteins. Manuscript submitted. (National Cancer Institute, National Institutes of Health).


Name: NCI_CGAP_Sub1
Library ID: 1453
Organism: Homo sapiens
Age: 0
Organ: mixed
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without


Name: NCI_CGAP_Sub2
Library ID: 1454
Organism: Homo sapiens
Age: 0
Organ: mixed
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without


Name: NCI_CGAP_Sub3
Library ID: 1455
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: This library is a mixture of the following 21 normalized or normalized/subtracted CGAP libraries: Co4, Pr22, Pr28, Co10, Co16, Kid5, Kid12, Kid3, Kid11, Lym2, Br2, Co8, CLL1, Lei2, Brn23, Lu5, Lu24, Lu19, GC4, GC6, and Brn25.
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without


Name: NCI_CGAP_Sub4
Library ID: 1456
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: This library is derived from a mixture of 21 normalized or normalized/subtracted CGAP libraries: NCI_CGAP_Co4, Pr22, Pr28, Co10, Co16, Kid5, Kid12, Kid3, Kid11, Lym2, Br2, Co8, CLL1, Lei2, Brn23, Lu5, Lu24, Lu19, GC4, GC6, and Brn25. This is an additional subtraction from the NCI_CGAP_Sub2 library.
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without


Name: NCI_CGAP_Sub5
Library ID: 1499
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pooled tissues: lung squamous cell carcinoma, poorly differentiated, 4 pooled tumors including primary and metastatic; B-cell; colon tumor; breast bulk tumor, pooled; colony tumor; bulk prostate; colon tumor RER+; 3 pooled germ cell tumors, including broad spectrum tumor types; 2 pooled kidneys; 2 pooled kidney tumors, clear cell type; glioblastoma, pooled; anaplastic oligodendroglioma; lymph node, follicular mixed small and large cell; neuroendocrine lunch carcinoid; colon adenocarcinoma; leiomyosarcoma, 2 pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This subtracted library was derived from a pool of thefollowing 21 normalized and/or subtracted libraries: NCI_CGAP_Co4, Pr22, Pr28, Co10, Co16, Kid5, Kid12, Kid3, Kid11, Lym2, Br2, Co8, CLL1, Lei2, Brn23, Lu5, Lu24, Lu19, GC4, GC6, and Brn25. Library was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Sub6
Library ID: 1500
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: mixed
Tissue: pooled tissues: ovary fibrotheoma; lung adenocarcinoma, poorly differentiated; medulloblastoma; flow-sorted tonsils
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This subtracted library was derived from a pool of thefollowing four normalized libraries: NCI_CGAP_Ov18, Lu13, GCB1, and Brn50. Library was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Sub7
Library ID: 1501
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: mixed
Tissue: pooled tissues: ovary fibrotheoma; lung adenocarcinoma, poorly differentiated; medulloblastoma; flow-sorted tonsils
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This subtracted library was derived from NCI_CGAP_Sub6.Library was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Sub8
Library ID: 1599
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pooled tissues: squamous cell carcinoma, poorly differentiated, 4 pooled tumors including primary and metastatic; 3 pooled germ cell tumors, including broad spectrum tumor types; glioblastoma, pooled; anaplastic oligodendroglioma; neuroendocrine lung carcinoid; leiomyosarcoma, 2 pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This subtracted library was derived from a mixture of the followingnormalized and/or subtracted libraries: NCI_CGAP_Co4, Pr22, Pr28, Co10, Co16, Kid5, Kid12, Kid3, Kid11, Lym2, Br2, Co8, CLL1, Lei2, Brn23, Lu5, Lu24, Lu19, GC4, GC6, and Brn25. Library was constructed by Bento Soares and M.Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Sub9
Library ID: 1927
Organism: Homo sapiens
Age: 0
Stage: mixed
Organ: mixed
Tissue: colonic mucosa (Crohn's disease), colonic mucosa (ulcerative colitis), fetal thymus, cervix, cervical adenosquamous carcinoma, ligament cells, prostate carcinoma, bladder carcinoma, brain oligodendroglioma
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: This subtracted library was derived from a pool of libraries and tissues: colonic mucosa from Crohn's disease (Soares/Dieckgraefe NHUC, normalized, tag TAGC), colonic mucosa from ulcerative colitis (Soares/Dieckgraefe NHCD, normalized, tag CGTC), fetal thymus (Soares NHFTh, normalized, tag AACG), cervix (Soares NHCe, normalized, tag GGGCC), cervical adenosquamous carcinoma (Soares NHCec, normalized, tag CGAAG), ligament cells, prostate carcinoma, bladder carcinoma, and brain oligodendroglioma (NCI_CGAP_Brn41, normalized, tag ATCAC). Library constructed by M. Bento Soares and Maria de Fatima Bonaldo (University of Iowa). Note: this is a NCI_CGAP Library.


Name: NIH_MGC_115
Library ID: 1784
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: mixed
Tissue: pool of lung, 6 brains and testis
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source anonymous pool of 6 male brains, age range 23-27; 1 male lung, age 27; and 1 male testis, age 69. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.8 kb, insert size range 1-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 021. Note: this is a NIH_MGC Library.


Name: NIH_MGC_116
Library ID: 1785
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: mixed
Tissue: pool of kidney (46 yo male), 2 stomachs (62 yo male, 70 yo female) and 3 colons (26 yo male, 49 yo female, 71 yo male)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source anonymous pool of 3 colons, age 26 yo male, 49 yo female, 71 yo male colon; 46 yo male kidney, and pool of 2 stomachs, 62 yo male and 70 yo female. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.4 kb, insert size range 1-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 023. Note: this is a NIH_MGC Library.


Name: NIH_MGC_117
Library ID: 1786
Organism: Homo sapiens
Gender: female
Age: 0
Stage: fetal
Organ: mixed
Tissue: pool of liver (21 wk female), brain (24 wk male) and 6 hearts (20-24 wks male and female)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source anonymous pool of 24 week male brain, 21 week female liver, and six male and female hearts ranging from 20-24 weeks. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 2.1 kb, insert size range 1-3.5 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 024. Note: this is a NIH_MGC Library.


Name: NIH_MGC_120
Library ID: 1789
Organism: Homo sapiens
Gender: male
Age: 28
Stage: adult
Organ: mixed
Tissue: liver and spleen
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source anonymous pool of spleen and pancreas from 28 yo male. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.5 kb, insert size range 1-2.5 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 025. Note: this is a NIH_MGC Library.


Name: NIH_MGC_122
Library ID: 1791
Organism: Homo sapiens
Gender: female
Age: 0
Stage: fetal
Organ: mixed
Tissue: pool of lung (20 wk female) and spleen (pooled from 24 wk female and 20-22 wk males)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source anonymous pool of 24 week female lung, 16 week female spleen, and 20-22 week male spleens. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.4 kb, insert size range 1-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 026. Note: this is a NIH_MGC Library.


Name: NIH_MGC_146
Library ID: 1960
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: mixed tissues
Host: DH10B TonA
Vector: pcDNA3.1
Vector type: plasmid
Insert digest: multiple
Stop Codon Status: without
Description: ORFs were PCR-amplified (from IMAGE clones or from commercially available cDNA libraries) and cloned by the Guthrie cDNA Resource Center ( into pcDNA3.1. For specific information on cloning sites (which vary by clone), please refer to the Guthrie website, using the Guthrie ID given in the file here.


Name: NIH_MGC_184
Library ID: 2029
Organism: Homo sapiens
Gender: neither
Age: 0
Organ: mixed
Tissue: glandular pool - thyroid, parathyroid, adrenal, cortex, pineal gland
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned. cDNA was prepared from a glandular pool of tissues from thyoid, parathyroid, adrenal, cortex and pineal gland. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.38 kb (range 0.60-3.5 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_186
Library ID: 2030
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: Skin and meninges pool - skin, dura matter, pia matter, and choroid plexus
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned. cDNA was prepared from a pooled samples of tissues from Skin, meninges, duramatter, pia matter and choroid plexus. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.47 kb (range 0.50-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_187
Library ID: 2031
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: Blood vessels, aorta, and basilar artery
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned. cDNA was prepared from a pooled samples of tissues from Blood vessels, aorta, basilar and artery. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.10 kb (range 0.50-3.5 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_195
Library ID: 2042
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: cDNA derived from either pooled cytoplasmic polyA RNA from 30 cells lines or pooled total RNA from 10 different tissues (from BD Biosciences/Clontech and Washington University).
Host: DH10B TonA
Vector: pDNR-Dual
Vector type: plasmid
Insert digest: 5' loxP-SalI/HindIII-loxP 3'
Stop Codon Status: without
Description: Clones from this library have been PCR-amplified using gene-specific primers to contain the complete open reading frame (based on known gene sequences available from NCBI's RefSeq). Template for PCR is cDNA derived from either pooled cytoplasmic polyA RNA from 30 cells lines or pooled total RNA from 10 different tissues (from BD Biosciences/Clontech and Washington University). PCR products are directionally cloned into the loxP sites of the pDNR-Dual vector. Library constructed by Dr. Narayan Bhat, Earl Bere III and Hongling Liao (Gene Expression Laboratory, Research Technology Program, SAIC Frederick, NCI-Frederick, Frederick, MD 21702). For information on which gene each clone represents, please visit our anonymous ftp site here. Note: this is a NIH_MGC Library. '


Name: NIH_MGC_217
Library ID: 2062
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: mixed
Tissue: 3 cell lines - Myxoid Chondrosarcoma Grade II. Cell line CS-7 (passage 2), 105KD, JJ
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 0.5-1Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Average insert size 0.5-1kb. Library was constructed in the laboratory of M. Bento Soares. Note: this is a NIH_MGC Library.


Name: NIH_MGC_218
Library ID: 2063
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: mixed
Tissue: 3 pooled cell lines of Myxoid Chondrosarcoma Grade II: CS-7 (passage 2), 105KC, JJ
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 0.5-1Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of


Name: NIH_MGC_219
Library ID: 2064
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: mixed
Tissue: 3 pooled cell lines of Myxoid Chondrosarcoma Grade II. Cell lines CS-7 (passage 2), 105KC, JJ
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 2-3Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter priner 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of M. Bento Soares. Note: this is a NIH_MGC Library


Name: NIH_MGC_220
Library ID: 2093
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: mixed
Tissue: Pool of 3 cell lines of Myxoid Chondrosarcoma Grade II tissue. CS-7(passage 2), 105KC and JJ
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 0.5-1Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of M. Bento Soares. Average insert size 3-4kb Note: this is a NIH_MGC Library.


Name: NIH_MGC_221
Library ID: 2094
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: mixed
Tissue: Pool of 3 cell lines from Chondrosarcoma Tumor. Cell lines CS-7 (passage 2), 105KC, JJ
Host: DH10B TonA
Vector: pYX-Asc
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned Denatured RNA was size fractionated on a 1% agarose gel. First strand cDNA synthesis was primed with oligo-dT primer containing a Not I site. Double strand cDNA was size selected according tomRNA size fraction, ligated with EcoR I adaptor, digested with Not I and then cloned directionally into pYX-Asc vector. Average insert size 4-5Kb. Adaptors 5'(AATTCGGCACGAGG)3' and 5'd (CCTCGTGCCG)3'. 3' Linker sequence - GCGGCCGCTGAGAGCC T18. Sequencing primers 3'end: T3 promoter primer 5'd (ATTAACCCTCACTAAAGGGA)3'. 5' End: T7 promoter primer 5'd (TAATACGACTCACTATAGGG)3'. Library was constructed in the laboratory of M. Bento Soares. Note: this is a NIH_MGC Library


Name: NIH_MGC_241
Library ID: 2167
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: mixed tissues from existing MGC libraries
Host: XL-1 Blue
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This library consists of a subset of clones from various MGC libraries that were found to have errors in their sequence, possibly the result of artifacts in cDNA library construction. These errors were repaired using site-directed mutagenesis by Modular Genetics Inc. (Woburn, MA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_244
Library ID: 2157
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: 20 tissues, mixed
Host: XL10 Gold
Vector: pPCR-Script Amp SK(+)
Vector type: plasmid
Insert digest: SrfI
Stop Codon Status: without
Description: Library was constructed from RT-PCR products generated from the BD Biosciences Clontech Human Total RNA Master Panel II (consisting of RNAs from 20 different tissues). Product from the RT-PCR was purified using QIAGEN PCR columns and ends were repaired for blunt-end ligation into the SrfI site of pPCR-Script Amp SK(+). Clones are oriented with 5' end nearest EcoRI site and 3' end nearest NotI site. Companion library NIH_MGC_277 has clones in the opposite orientation. Reference: Wu et al. (2004, Biotechniques in press). Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_245
Library ID: 2169
Organism: Homo sapiens
Age: 0
Organ: mixed
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_271 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_271
Library ID: 2203
Organism: Homo sapiens
Age: 0
Organ: mixed
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_245 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_277
Library ID: 2209
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: 20 tissues, mixed
Host: DH10B TonA
Vector: pPCR-Script Amp SK(+)
Vector type: plasmid
Insert digest: SrfI
Stop Codon Status: without
Description: Library was constructed from RT-PCR products generated from the BD Biosciences Clontech Human Total RNA Master Panel II (consisting of RNAs from 20 different tissues). Product from the RT-PCR was purified using QIAGEN PCR columns and ends were repaired for blunt-end ligation into the SrfI site of pPCR-Script Amp SK(+). Clones are oriented with 5' end nearest the NotI site and 3' end nearest the EcoRI site. Companion library NIH_MGC_244 has clones in the opposite orientation. Reference: Wu et al. (2004, Biotechniques in press). Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_282
Library ID: 2251
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: 20 tissues, mixed
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Library was constructed from RT-PCR products generated from the BD Biosciences Clontech Human Total RNA Master Panel II (consisting of RNAs from 20 different tissues). Inserts are cloned into the TOPO site and oriented with 5' end nearest the SpeI site and 3' end nearest the PstI site. Inserts can be excised using EcoRI. Companion library NIH_MGC_283 has clones in the opposite orientation. Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a NIH_MGC Library.


Name: NIH_MGC_283
Library ID: 2252
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: 20 tissues, mixed
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Library was constructed from RT-PCR products generated from the BD Biosciences Clontech Human Total RNA Master Panel II (consisting of RNAs from 20 different tissues). Inserts are cloned into the TOPO site and oriented with 5' end nearest the PstI site and 3' end nearest the SpeI site. Inserts can be excised using EcoRI. Companion library NIH_MGC_282 has clones in the opposite orientation. Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a NIH_MGC Library.


Name: NIH_MGC_314
Library ID: 2274
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of lung and heart
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_315 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_315
Library ID: 2275
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of lung and heart
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_314 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_316
Library ID: 2296
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of lung and heart
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_317 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_317
Library ID: 2297
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of lung and heart
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_316 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_318
Library ID: 2276
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of brain, heart and lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_319 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_319
Library ID: 2277
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of brain, heart and lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_318 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_320
Library ID: 2298
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of brain, heart and lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_321 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_321
Library ID: 2299
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of brain, heart and lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_320 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_322
Library ID: 2278
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebral cortex and lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_323 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_323
Library ID: 2279
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebral cortex and lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_322 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_324
Library ID: 2300
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebral cortex and lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_325 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_325
Library ID: 2301
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebral cortex and lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_324 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_326
Library ID: 2280
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of lung and placenta
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_327 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_327
Library ID: 2281
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of lung and placenta
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_326 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_328
Library ID: 2302
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of lung and placenta
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_329 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_329
Library ID: 2303
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of lung and placenta
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_328 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_330
Library ID: 2306
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: cDNA derived from either pooled cytoplasmic polyA RNA from 30 cells lines or pooled total RNA from 10 different tissues (from BD Biosciences/Clontech and Washington University).
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones from this library have been PCR-amplified using gene-specific primers to contain the complete open reading frame (based on known gene sequences available from NCBI's RefSeq). Template for PCR is cDNA derived from either pooled cytoplasmic polyA RNA from 30 cells lines or pooled total RNA from 10 different tissues (from BD Biosciences/Clontech and Washington University). PCR products are non-directionally cloned into the TOPO sites of the pCR-BluntII-TOPO vector. Library constructed by Dr. Narayan Bhat, Earl Bere III and Hongling Liao (Gene Expression Laboratory, Research Technology Program, SAIC Frederick, NCI-Frederick, Frederick, MD 21702). For information on which gene each clone represents, and the orientation in which it's cloned (determined by sequence analysis; this library represents the forward direction and NIH_MGC_332 represents the reverse direction) please visit our anonymous ftp site here. Note: this is a NIH_MGC Library.


Name: NIH_MGC_332
Library ID: 2317
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: cDNA derived from either pooled cytoplasmic polyA RNA from 30 cells lines or pooled total RNA from 10 different tissues (from BD Biosciences/Clontech and Washington University).
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones from this library have been PCR-amplified using gene-specific primers to contain the complete open reading frame (based on known gene sequences available from NCBI's RefSeq). Template for PCR is cDNA derived from either pooled cytoplasmic polyA RNA from 30 cells lines or pooled total RNA from 10 different tissues (from BD Biosciences/Clontech and Washington University). PCR products are non-directionally cloned into the TOPO sites of the pCR-BluntII-TOPO vector. Library constructed by Dr. Narayan Bhat, Earl Bere III and Hongling Liao (Gene Expression Laboratory, Research Technology Program, SAIC Frederick, NCI-Frederick, Frederick, MD 21702). For information on which gene each clone represents, and the orientation in which it's cloned (determined by sequence analysis; this library represents the reverse direction and NIH_MGC_330 represents the forward direction) please visit our anonymous ftp site here. Note: this is a NIH_MGC Library.


Name: NIH_MGC_333
Library ID: 2322
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebral cortex, heart, lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_334 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_334
Library ID: 2323
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebral cortex, heart, lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_333 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_335
Library ID: 2324
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebral cortex, heart, lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_336 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_336
Library ID: 2325
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebral cortex, heart, lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_335 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_337
Library ID: 2326
Organism: Homo sapiens
Gender: both
Age: 0
Organ: mixed
Tissue: pool of cerebellum, uterus, testis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_338 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_338
Library ID: 2327
Organism: Homo sapiens
Gender: both
Age: 0
Organ: mixed
Tissue: pool of cerebellum, uterus, testis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_337 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_339
Library ID: 2328
Organism: Homo sapiens
Gender: both
Age: 0
Organ: mixed
Tissue: pool of cerebellum, uterus, testis
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_340 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_340
Library ID: 2329
Organism: Homo sapiens
Gender: both
Age: 0
Organ: mixed
Tissue: pool of cerebellum, uterus, testis
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_339 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_341
Library ID: 2330
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, uterus, ovary
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_342 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_342
Library ID: 2331
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, uterus, ovary
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_341 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_343
Library ID: 2332
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, uterus, ovary
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_344 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_344
Library ID: 2333
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, uterus, ovary
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_343 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_345
Library ID: 2334
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum and lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_346 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_346
Library ID: 2335
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum and lung
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_345 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_347
Library ID: 2336
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum and lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_348 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_348
Library ID: 2337
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum and lung
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_347has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_349
Library ID: 2344
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of bladder, uterus, placenta
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_350 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_350
Library ID: 2345
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of bladder, uterus, placenta
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_349 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_351
Library ID: 2346
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of bladder, uterus, placenta
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_352 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_352
Library ID: 2347
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of bladder, uterus, placenta
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_351 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_353
Library ID: 2348
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, bladder, kidney
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_354 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_354
Library ID: 2349
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, bladder, kidney
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_353 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_355
Library ID: 2350
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, bladder, kidney
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_356 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_356
Library ID: 2351
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, bladder, kidney
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_355 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_357
Library ID: 2352
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of bladder, uterus
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_358 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_358
Library ID: 2353
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of bladder, uterus
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_357 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_359
Library ID: 2354
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of bladder, uterus
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_360 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_360
Library ID: 2355
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of bladder, uterus
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_359 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_361
Library ID: 2356
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, kidney, placenta, testis, lung, colon, liver, heart, thyroid, bladder, uterus
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_362 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_362
Library ID: 2357
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, kidney, placenta, testis, lung, colon, liver, heart, thyroid, bladder, uterus
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_361 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_363
Library ID: 2358
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, kidney, placenta, testis, lung, colon, liver, heart, thyroid, bladder, uterus
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_364 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_364
Library ID: 2359
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of cerebellum, kidney, placenta, testis, lung, colon, liver, heart, thyroid, bladder, uterus
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_363 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_397
Library ID: 2434
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: 20 tissues, mixed
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Library was constructed from RT-PCR products generated from the BD Biosciences Clontech Human Total RNA Master Panel II (consisting of RNAs from 20 different tissues). Inserts are cloned into the TOPO site and oriented with 5' end nearest the SpeI site and 3' end nearest the PstI site. Inserts can be excised using EcoRI. Companion library NIH_MGC_398 has clones in the opposite orientation. Clones from this library represent predicted genes. Library constructed at Baylor College of Medicine, human Genome Sequencing Center. Note: this is a NIH_MGC Library.


Name: NIH_MGC_398
Library ID: 2435
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: 20 tissues, mixed
Host: DH10B TonA
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Library was constructed from RT-PCR products generated from the BD Biosciences Clontech Human Total RNA Master Panel II (consisting of RNAs from 20 different tissues). Inserts are cloned into the TOPO site and oriented with 5' end nearest the PstI site and 3' end nearest the SpeI site. Inserts can be excised using EcoRI. Companion library NIH_MGC_397 has clones in the opposite orientation. Clones from this library represent predicted genes. Library constructed at Baylor College of Medicine, Human Genome Sequencing Center. Note: this is a NIH_MGC Library.

Soares 1NFLS

Name: Soares 1NFLS
Library ID: 59
Organism: Homo sapiens
Gender: male
Age: 0
Stage: fetal
Organ: mixed
Tissue: spleen and liver
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Pac I - oligo(dT) primer[5' AACTGGAAGAATTAATTAAAGATCTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.

Soares 1NFLS-S1

Name: Soares 1NFLS-S1
Library ID: 251
Organism: Homo sapiens
Gender: male
Age: 0
Stage: fetal
Organ: mixed
Tissue: spleen and liver
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: DNAs from I.M.A.G.E. clones 66696-67079 and 108168-112775(which are from the Soares 1NFLS library) were used as a driver in a subtraction of the 1NFLS library to make the 1NFLS-S1 library.

Soares NbHPU

Name: Soares NbHPU
Library ID: 253
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: mixed
Tissue: colon tumor, uterus
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCTTTTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

Soares NFL_T_GBC_S1

Name: Soares NFL_T_GBC_S1
Library ID: 689
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of lung (19 wks post conception), testis (adult) and flow-sorted tonsils (adult)
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Equal amounts of plasmid DNA from three normalized libraries(fetal lung NbHL19W, testis NHT, and B-cell NCI_CGAP_GCB1) were mixed, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from pools of 5,000 clones made from the same 3 libraries. The pools consisted of I.M.A.G.E. clones 297480-302087, 682632-687239, 726408-728711, and 729096-731399. Subtraction by Bento Soares and M. Fatima Bonaldo.

Soares NhHMPu-S1

Name: Soares NhHMPu-S1
Library ID: 363
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of heart (19 wks postconception), melanocyte (adult) and uterus (adult)
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Equal amounts of plasmid DNA from three normalized libraries(melanocyte 2NbHM, pregnant uterus NbHPU, and fetal heart NbHH19W) were mixed, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from pools of 5,000 clones made from the same 3 libraries. The pools consisted of I.M.A.G.E. clones 260232-265223, 340488-345479, and 484488-489479. Library constructed by Bento Soares and M. Fatima Bonaldo.

Soares NSF-F8-9W-OT-PA-P-S1

Name: Soares NSF-F8-9W-OT-PA-P-S1
Library ID: 788
Organism: Homo sapiens
Age: 0
Organ: mixed
Tissue: pool of fetus (8-9 wks postconception), full-term placenta obtained at birth, ovary papillary serous cystadenocarcinoma grade III tumor with surface extensions and metastases (36 yo female), 3 pooled parathyroid glands with primary hyperparathyroidism, fibroblast senescent cells
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Equal amounts of plasmid DNA from five normalized librarieswere mixed, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from pools of 5,000 clones made from the same 5 libraries. The pools consisted of the following libraries and cloneIDs: Soares NbHSF pool 1: 309384-310919, 323208-325895 Soares Nb2HP pool 1: 145032-147335, 147720-148103, 148872-149255, 150024- 150407, 151176-152327 Soares Nb2HF8-9W pool 1: 758280-760583, 772104-774407 Soares NbHPA pool 1: 304776-306311, 320136-322823, 326280-326663 Soares NbHOT pool 1: 723720-726407, 739080-740999 Subtraction by Bento Soares and M. Fatima Bonaldo.


Library ID: 1387
Organism: Homo sapiens
Age: 0
Organ: mouth
Tissue: carcinoma in situ from retromolar trigone
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1460
Organism: Homo sapiens
Age: 0
Organ: mouth
Tissue: leukoplakia of the buccal mucosa
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from leukoplakia, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1461
Organism: Homo sapiens
Age: 0
Organ: mouth
Tissue: moderate to poorly differentiated invasive carcinoma of the retromolar trigone
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1395
Organism: Homo sapiens
Age: 0
Organ: mouth
Tissue: normal squamous epithelium from floor of mouth
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1390
Organism: Homo sapiens
Age: 0
Organ: mouth
Tissue: well-differentiated invasive carcinoma, floor of mouth
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1391
Organism: Homo sapiens
Age: 0
Organ: mouth
Tissue: normal squamous epithelium from retromolar trigone
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.

Barstead HPL-RB8

Name: Barstead HPL-RB8
Library ID: 1323
Organism: Homo sapiens
Gender: female
Age: 27
Stage: adult
Organ: muscle
Tissue: Psoas muscle
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to Eco RI adaptors [5' AATTCACTAGTAAC 3' and 5' GTTACTAGTG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Clontech muscle (HL3000s)

Name: Clontech muscle (HL3000s)
Library ID: 74
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: muscle
Tissue: skeletal muscle
Host: MC1061/P3
Vector: pcDNAI
Vector type: plasmid
Insert digest: 5' BstXI/NotI 3'
Stop Codon Status: without


Name: NCI_CGAP_Alv1
Library ID: 474
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: muscle
Tissue: alveolar rhabdomyosarcoma, striated muscle
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from alveolar rhabdomyosarcoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 407
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: muscle
Tissue: bulk alveolar rhabdomyosarcoma
Host: DH10B
Vector: pCMV-SPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_123
Library ID: 1792
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: muscle
Tissue: pool of skeletal muscle (57 yo female), breast (58 yo female) and heart (24 yo male)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source anonymous pool of male heart, age 24; female skeletal muscle, age 57, and female breast, age 58. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.5 kb, insert size range 1-3 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 022. Note: this is a NIH_MGC Library.


Name: NIH_MGC_17
Library ID: 1429
Organism: Homo sapiens
Age: 0
Organ: muscle
Tissue: rhabdomyosarcoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_183
Library ID: 2028
Organism: Homo sapiens
Age: 0
Organ: muscle
Tissue: Muscle pool (cardiac and skeletal muscle)
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.7. Library was constructed by Invitrogen. Note: this is a NIH_MGC Library.


Name: NIH_MGC_81
Library ID: 1644
Organism: Homo sapiens
Age: 0
Organ: muscle
Tissue: skeletal muscle
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.55 kb (range 1.0-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.

Stratagene skeletal muscle (937209)

Name: Stratagene skeletal muscle (937209)
Library ID: 270
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: muscle
Tissue: skeletal muscle from patient with malignant hyperthermia
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Skeletal muscle from patient with malignant hyperthermia. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Weizmann olfactory epithelium

Name: Weizmann olfactory epithelium
Library ID: 121
Organism: Homo sapiens
Gender: female
Age: 35
Stage: adult
Organ: olfactory epithelium
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Olfactory epithelium, normal. Average insert size: 0.8 kb; Uni-ZAP XR Vector. Library constructed by N. Walker, D. Lancet, Weizmann Institute of Science. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'


Name: NCI_CGAP_Ov1
Library ID: 405
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: bulk tumor
Host: DH10B
Vector: pCMV-SPORT2
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov10
Library ID: 786
Organism: Homo sapiens
Gender: female
Age: 0
Organ: ovary
Tissue: poorly differentiated adenocarcinoma
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 0.3 kb. Life Technologies catalog #: 10983-013 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov11
Library ID: 787
Organism: Homo sapiens
Gender: female
Age: 0
Organ: ovary
Tissue: well differentiated papillary adenocarcinoma
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 0.6 kb. Life Technologies catalog #: 10983-013 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov18
Library ID: 1345
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: ovary, fibrotheoma
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGCGACATTTTTTTTTTTTTTTTTT 3']; double- stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov2
Library ID: 473
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: invasive tumor
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from invasive ovarian tumor, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov23
Library ID: 1239
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: primary tumors, metastasis positive, 5 pooled including mixed Mullerian tumor, papillary serous, clear cell, spindle cell
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.35 kb. Tumor types include: mixed Mullerian tumor, papillary serous, clear cell, spindle cell. All are primary tumors, metastasis positive. Life Technologies catalog #: 11534-013 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov26
Library ID: 1206
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: papillary serous ovarian carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from papillary serous ovarian carcinoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov31
Library ID: 1236
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: papillary serous ovarian carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from ovarian carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Non-amplified library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov32
Library ID: 1237
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: papillary serous ovarian carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from ovarian carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Non-amplified library. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov33
Library ID: 1287
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: borderline ovarian carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from borderline ovarian carcinoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. CITATION: National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index CONT_NAME: Robert Strausberg, Ph.D. COMMENT: cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. cDNA Library Arrayed by: I.M.A.G.E. Consortium, LLNL DNA Sequencing by: Washington University Genome Sequencing Center Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov34
Library ID: 1286
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: borderline ovarian carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from borderline ovarian carcinoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. CITATION: National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index CONT_NAME: Robert Strausberg, Ph.D. COMMENT: cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. cDNA Library Arrayed by: I.M.A.G.E. Consortium, LLNL DNA Sequencing by: Washington University Genome Sequencing Center Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov35
Library ID: 1330
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: primary tumors, metastasis positive, 5 pooled including mixed Mullerian tumor, papillary serous, clear cell, spindle cell
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: This library represents the normalized version of NCI_CGAP_Ov23. Cloned unidirectionally. Primer: Oligo dT. Average insert size 0.86 kb. Tumor types include: mixed Mullerian tumor, papillary serous, clear cell, spindle cell. All are primary tumors, metastasis positive. Constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov36
Library ID: 1285
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: borderline ovarian carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from borderline ovarian carcinoma, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov37
Library ID: 1301
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: early stage papillary serous ovarian carcinoma
Host: DH10B
Vector: pAMP1
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from ovary carcinoma tissue, cDNA made by oligo-dT priming. Directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 400 bp. Primary library, non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov38
Library ID: 1349
Organism: Homo sapiens
Gender: female
Age: 0
Organ: ovary
Tissue: pool of 3 cell lines: transfected epithelium, untransfected epithelium, epithelium with BRCA1 mutation (5256delG)
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov39
Library ID: 1393
Organism: Homo sapiens
Gender: female
Age: 0
Organ: ovary
Tissue: papillary serous ovarian carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov40
Library ID: 1394
Organism: Homo sapiens
Gender: female
Age: 0
Organ: ovary
Tissue: endometrioid ovarian metastasis
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov41
Library ID: 1466
Organism: Homo sapiens
Gender: female
Age: 0
Organ: ovary
Tissue: serous papillary tumor
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.4 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov5
Library ID: 592
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: surface epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal ovarian epithelium, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov6
Library ID: 593
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: cortical stroma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal ovarian cortical stroma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ov8
Library ID: 731
Organism: Homo sapiens
Age: 0
Organ: ovary
Tissue: serous adenocarcinoma
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Life Technologies catalog #: 10982-015 Note: this is a NCI_CGAP Library.


Name: NICHD_Hs_Ov1
Library ID: 2057
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: Granulosa lutein cells aspirated from preovulator follicles of normal cycling women undergoing ovulation induction of infertility due to male factor and normal doners. The cells were from follicles stimulated with Lupron, FSH and hCG. Polled tissures from Percoll purified granulosa lutein cells.
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned. Granulosa lutein cells aspirated from preovulatory folicles of normal cycling women undergoing ovulation induction for infertility due to male factor and normal doners. The cells were from follicles stimulated with Lupron, FSH and hCG. 5' and 3' adaptors were used in cloning as follows: 5' adaptor sequence: 5'-CACGGCCATTATGGCC-3' and 3' adaptor sequence: 5'-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3' (where B = A, C, or G and N = A, C, G, or T). Average insert size 2.23 kb (range 1.0-4.5 kb). 14/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA).


Name: NIH_MGC_109
Library ID: 1860
Organism: Homo sapiens
Gender: female
Age: 0
Organ: ovary
Tissue: teratocarcinoma, cell line
Host: DH10B TonA
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_125
Library ID: 1862
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: ovary
Tissue: pool of 3 ovaries
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: RNA source pool of three ovaries, from females ranging in age from 38 to 49 yo. Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 2.1 kb, insert size range 1-3.5 kb. Library is normalized and enriched for full-length clones and was constructed by C. Gruber (Invitrogen). Research Genetics tracking code 036. Note: this is a NIH_MGC Library.


Name: NIH_MGC_66
Library ID: 1615
Organism: Homo sapiens
Gender: female
Age: 0
Organ: ovary
Tissue: adenocarcinoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.8 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library.


Name: NIH_MGC_9
Library ID: 1426
Organism: Homo sapiens
Age: 0
Organ: ovary
Tissue: ovarian adenocarcinoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.

Soares NbHOT

Name: Soares NbHOT
Library ID: 116
Organism: Homo sapiens
Gender: female
Age: 36
Stage: adult
Organ: ovary
Tissue: papillary serous cystadenocarcinoma grade III tumor with surface extensions and metastases
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA (prepared from a papillary serous cystadenocarcinomagrade III tumor with surface extensions and metastases) was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCGGTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot53. Library constructed by Bento Soares and M. Fatima Bonaldo.

Stratagene ovary (937217)

Name: Stratagene ovary (937217)
Library ID: 65
Organism: Homo sapiens
Gender: female
Age: 49
Stage: adult
Organ: ovary
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Total ovary tissue, normal, caucasian. Average insert size: 0.8 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Stratagene ovary tumor (937219)

Name: Stratagene ovary tumor (937219)
Library ID: 274
Organism: Homo sapiens
Gender: female
Age: 64
Stage: adult
Organ: ovary
Tissue: papillary serous carcinoma, isolated from ascites
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Papillary serous carcinoma, isolated from ascites, 64 year old caucasian. Average insert size: 0.8 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Barstead HPL-RB1

Name: Barstead HPL-RB1
Library ID: 719
Organism: Homo sapiens
Gender: female
Age: 34
Stage: adult
Organ: pancreas
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [AATTCGGATCCATG and CATGGATCCG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

HR85 islet

Name: HR85 islet
Library ID: 1775
Organism: Homo sapiens
Age: 0
Organ: pancreas
Tissue: pancreatic islet
Host: DH10B TonA
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' XhoI/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Size-selected on agarose gel for averageinsert size 1.5 kb. 5' XhoI site was destroyed after directional cloning. Library was amplified once. Please contact Hiroshi Inoue, MD/PhD for further information on this library (Metabolism Division, Permutt Laboratory, Washington University School of Medicine, Box 8127, 660 S Euclid Ave, St. Louis, MO 63110). Note: this is a Washington University Pancreas EST project library.

Human insulinoma

Name: Human insulinoma
Library ID: 1749
Organism: Homo sapiens
Age: 0
Organ: pancreas
Tissue: insulinoma
Host: GeneHogs DH10B
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Constructed with lambda ZAPII system (Stratagene) by Dr. J.Ferrer, in vivo mass-excised to pBluescript SK- by Dr. H. Inoue following the Washington University protocol ( Please contact Hiroshi Inoue, MD/PhD for further information on this library (Metabolism Division, Permutt Laboratory, Washington University School of Medicine, Box 8127, 660 S Euclid Ave, St. Louis, MO 63110). Note: this is a Washington University Pancreas EST project library.

Melton human islets HIZ1

Name: Melton human islets HIZ1
Library ID: 1909
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: pancreas
Tissue: Islets of Langerhans, pooled
Host: TOP10
Vector: pZERO-2
Vector type: plasmid
Insert digest: 5' XhoI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows. 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. XhoI site destroyed during cloning (excise insert using XbaI/NotI). Size-selected by column fractionation; average insert size 1.59kb. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Melton human pancreatic islets

Name: Melton human pancreatic islets
Library ID: 1908
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: pancreas
Tissue: Islets of Langerhans, pooled
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows. 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.08kb. Primary library, unamplified. Library constructed and arrayed in the laboratory of D. Melton, Ph.D. (Harvard University).

Melton normalized human islet 4 N4-HIS1

Name: Melton normalized human islet 4 N4-HIS1
Library ID: 1898
Organism: Homo sapiens
Gender: both
Age: 0
Stage: adult
Organ: pancreas
Tissue: Islets of Langerhans, pooled
Host: DH10B
Vector: pSPORT1
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Starting library constructed using SuperScript Plasmid Library kit (Life Technologies) and 5' linker sequences as follows. 5'-TCGACCCACGCGTCCG-3' and 3'-GGGTGCGCAGGC-5'. cDNA made by oligo-dT priming using 5'-PGACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size-selected by column fractionation; average insert size 1.08 kb. Library was amplified once on solid support and plasmid DNA from library was prepared. The library DNA was normalized by method #4 from Bonaldo, Lennon, and Soares (1996 Genome Research 6:791-806); 0.5 microgram single-stranded library plasmid DNA was mixed with 5 micrograms PCR product representing library inserts and hybridized to an Ecot of 20. Single-stranded (unhybridized) plasmids were isolated by hydroxyapatite chromatography and used to make this library. Library arrayed and constructed in the laboratory of D. Melton, Ph.D. (Harvard University).


Name: NCI_CGAP_Pan1
Library ID: 1275
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: pancreas
Tissue: adenocarcinoma
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.72 kb. Life Technologies catalog #: 11548-013 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pan3
Library ID: 1467
Organism: Homo sapiens
Age: 0
Organ: pancreas
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Library ID: 531
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: pancreas
Tissue: pooled pancreatic islet tumors
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pooled pancreatic islet tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.2 kb. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_110
Library ID: 1814
Organism: Homo sapiens
Age: 0
Organ: pancreas
Tissue: ductal carcinoma, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_39
Library ID: 1571
Organism: Homo sapiens
Age: 0
Organ: pancreas
Tissue: adenocarcinoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_42
Library ID: 1706
Organism: Homo sapiens
Age: 0
Organ: pancreas
Tissue: epithelioid carcinoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_70
Library ID: 1619
Organism: Homo sapiens
Age: 0
Organ: pancreas
Tissue: epithelioid carcinoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library.


Name: NIH_MGC_78
Library ID: 1652
Organism: Homo sapiens
Age: 0
Organ: pancreas
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.2 kb (range 0.5-4.0 kb). 14/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.

Stratagene pancreas tumor (937208)

Name: Stratagene pancreas tumor (937208)
Library ID: 269
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: pancreas
Tissue: adenocarcinoma cell line CF Pac-1
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pancreatic adenocarcinoma cell line CF Pac-1. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Takeda/Bell pancreatic islet

Name: Takeda/Bell pancreatic islet
Library ID: 228
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: pancreas
Tissue: pooled pancreatic islets (90% pure)
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Normal adult pancreatic islets, estimated to be 90% pure, were source of mRNA. Uni-ZAP XR Vector. Reference: Human Molecular Genetics 2, 1793-1798 (1993) Library constructed by J. Takeda, G. Bell. ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Soares NbHPA

Name: Soares NbHPA
Library ID: 218
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: parathyroid
Tissue: three pooled with primary hyperparathyroidism
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA (prepared from RNA of 3 parathryoid adenomasfrom adults with primary hyperparathyroidism, provided by Stephen Marx and Allen Spiegel, NIH) was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCACCAATTTTTTTTTTTTTTTTTTTT 3'], double- stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, and was constructed by Bento Soares and M. Fatima Bonaldo.

Human Anterior Horn

Name: Human Anterior Horn
Library ID: 2048
Organism: Homo sapiens
Age: 0
Organ: peripheral nervous system
Tissue: anterior horn
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 2.1 kb. Library was constructed by Invitrogen and donated by J. Lupski, M.D./Ph.D. (Baylor College of Medicine).

Lupski dorsal root ganglion

Name: Lupski dorsal root ganglion
Library ID: 1514
Organism: Homo sapiens
Gender: male
Age: 36
Stage: adult
Organ: peripheral nervous system
Tissue: dorsal root ganglia
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned using the following adaptors: 5'-TCGACCCACGCGTCCG-3' and 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size selected > 1 kb for average insert length 1.7 kb. This is a primary library, non-amplified. Library constructed by Life Technologies and donated by J. Lupski, M.D./Ph.D. (Baylor College of Medicine) and is available through Life Technologies.

Lupski sciatic nerve

Name: Lupski sciatic nerve
Library ID: 1513
Organism: Homo sapiens
Gender: male
Age: 70
Stage: adult
Organ: peripheral nervous system
Tissue: sciatic nerve
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned using the following adaptors: 5'-TCGACCCACGCGTCCG-3' and 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size selected > 1 kb for average insert length 1.87 kb. This is a primary library, non-amplified. Library constructed by Life Technologies and donated by J. Lupski, M.D./Ph.D. (Baylor College of Medicine) and is available through Life Technologies.

Lupski sympathetic trunk

Name: Lupski sympathetic trunk
Library ID: 1660
Organism: Homo sapiens
Gender: male
Age: 16
Stage: adult
Organ: peripheral nervous system
Tissue: sympathetic trunk
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned using the following adaptors: 5'-TCGACCCACGCGTCCG-3' and 5'-GACTAGTTCTAGATCGCGAGCGGCCGCCCT(15)-3'. Size selected > 1 kb for average insert length 1.9 kb. This is a primary library, non-amplified. Library constructed by Life Technologies and donated by J. Lupski, M.D./Ph.D. (Baylor College of Medicine); available through Life Technologies.


Library ID: 734
Organism: Homo sapiens
Age: 0
Organ: peripheral nervous system
Tissue: dorsal root gangion
Host: DH10B
Vector: pCMV-SPORT4
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.1 kb. Life Technologies catalog #: 10988-012 Note: this is a NCI_CGAP Library.


Library ID: 1517
Organism: Homo sapiens
Age: 0
Organ: pharynx
Tissue: nasopharyngeal epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal nasopharyngeal epithelium, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1518
Organism: Homo sapiens
Age: 0
Organ: pharynx
Tissue: nasopharyngeal carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without


Library ID: 1519
Organism: Homo sapiens
Age: 0
Organ: pharynx
Tissue: nasopharyngeal epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from nasopharyngeal epithelium, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 765
Organism: Homo sapiens
Age: 0
Organ: pharynx
Tissue: squamous cell carcinoma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.5 kb. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' (GA)10ACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3' Library constructed by Stratagene. Note: this is a NCI_CGAP Library.

Soares 1NbHPG

Name: Soares 1NbHPG
Library ID: 114
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: pineal gland
Tissue: pool of 3
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA (prepared from post mortem tissue) was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGTTTTTTTTTTTTTTTTTT 3'], double- stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot40. Library constructed by Bento Soares and M. Fatima Bonaldo.

Soares 3NbHPG

Name: Soares 3NbHPG
Library ID: 115
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: pineal gland
Tissue: 3 pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA (prepared from post mortem tissue) was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCGTTTTTTTTTTTTTTTTTT 3'], double- stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization, to Cot38. Library constructed by Bento Soares and M. Fatima Bonaldo.


Name: NIH_MGC_179
Library ID: 2024
Organism: Homo sapiens
Age: 0
Organ: pituitary gland
Tissue: pituitary
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.1 kb. Library was constructed by Invitrogen. Note: this is a NIH_MGC Library.

Gatewood hydatidiform mole

Name: Gatewood hydatidiform mole
Library ID: 745
Organism: Homo sapiens
Age: 0
Stage: placental
Organ: placenta
Tissue: hydatidiform mole
Host: TOP10
Vector: pCDNAII
Vector type: phagemid
Insert digest: NotI
Stop Codon Status: without
Description: Hydatidiform mole is an abnormal human pregnancy which is encoded exclusively by the paternal genome. Complete hydatidiform mole consists of placental tissue only. First stand synthesis was initiated using a polyT-NotI primer. Following addition of BstX1 linkers, the completed cDNA was restricted with NotI. The restricted cDNA was size fractionated on agarose and the portion >2 kb was cloned into the plasmid vector pcDNAII (Invitrogen). The original tranformation mix was frozen in glycerol without amplification and clones were arrayed directly from that glycerol stock. Library prepared by Dr. Joe Gatewood (Los Alamos National Laboratory). REF: "Gene Expression in an Abnormal Human Pregnancy", Joe M. Gatewood, Beckie Lobb, Cheryl Lemanski, Karen Denison, and Virgene Church.


Name: NIH_MGC_10
Library ID: 1422
Organism: Homo sapiens
Age: 0
Organ: placenta
Tissue: choriocarcinoma cell line
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.4 kb. Library prepared by Life Technologies. Note: this is a NIH_MGC Library.


Name: NIH_MGC_11
Library ID: 1563
Organism: Homo sapiens
Age: 0
Organ: placenta
Tissue: choriocarcinoma cell line
Host: GeneHogs DH10B
Vector: pDNR-NCI
Vector type: phagemid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA.
5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence:
5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence:
5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.65 kb (range 0.9-3.0 kb).
This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA).
Note: this is a NIH_MGC Library.


Name: NIH_MGC_147
Library ID: 1964
Organism: Homo sapiens
Age: 0
Stage: placental
Organ: placenta
Host: DH10B TonA
Vector: pBluescriptR
Vector type: phagemid
Insert digest: 5' SalI-XhoI/BamHI 3'
Stop Codon Status: without
Description: Oligo-dT primed using primer 5''-TTTTTTTTTTTTTTTTVN-3'', size-selected for average insert size 2.3 kb and normalized to ROT 5. This is a primary library enriched for full-length clones and constructed using the Cap-trapper method (Carninci, in preparation). Library constructed by M. Brownstein (NIMH/NHGRI, National Institutes of Health). Note: this is a NIH_MGC Library.


Name: NIH_MGC_148
Library ID: 1966
Organism: Homo sapiens
Age: 0
Stage: placental
Organ: placenta
Tissue: pre-eclamptic placenta
Host: DH10B TonA
Vector: pBluescriptR
Vector type: phagemid
Insert digest: 5' SalI-XhoI/BamHI 3'
Stop Codon Status: without
Description: Oligo-dT primed using primer 5''-TTTTTTTTTTTTTTTTVN-3'', size-selected for average insert size 2.3 kb and normalized to ROT 5. This is a primary library enriched for full-length clones and constructed using the Cap-trapper method (Carninci, in preparation). Library constructed by M. Brownstein (NIMH/NHGRI, National Institutes of Health). Note: this is a NIH_MGC Library.


Name: NIH_MGC_21
Library ID: 1431
Organism: Homo sapiens
Age: 0
Organ: placenta
Tissue: choriocarcinoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_302
Library ID: 2268
Organism: Homo sapiens
Age: 0
Organ: placenta
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_303 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_303
Library ID: 2269
Organism: Homo sapiens
Age: 0
Organ: placenta
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_302 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_304
Library ID: 2290
Organism: Homo sapiens
Age: 0
Organ: placenta
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_305 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_305
Library ID: 2291
Organism: Homo sapiens
Age: 0
Organ: placenta
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_304 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_79
Library ID: 1658
Organism: Homo sapiens
Age: 0
Organ: placenta
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.3 kb (range 0.5-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.

Soares 2NbHP8-9W

Name: Soares 2NbHP8-9W
Library ID: 189
Organism: Homo sapiens
Age: 0
Stage: placental
Organ: placenta
Tissue: two pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' AACTGGAAGAATTCGCGGCCGCGATTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.

Soares Nb2HP

Name: Soares Nb2HP
Library ID: 77
Organism: Homo sapiens
Age: 0
Stage: placental
Organ: placenta
Tissue: full-term placenta obtained at birth
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' AACTGGAAGAATTCGCGGCCGCAGGAATTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.

Stratagene placenta (937225)

Name: Stratagene placenta (937225)
Library ID: 61
Organism: Homo sapiens
Gender: male
Age: 0
Stage: fetal
Organ: placenta
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Caucasian. Average insert size: 1.2 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'

Barstead HPL-RB4

Name: Barstead HPL-RB4
Library ID: 1060
Organism: Homo sapiens
Gender: male
Age: 89
Stage: adult
Organ: prostate
Tissue: BPH
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGTCGACATC 3' and 5' GATGTCGACG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Barstead HPL-RB4.1

Name: Barstead HPL-RB4.1
Library ID: 1295
Organism: Homo sapiens
Gender: male
Age: 89
Stage: adult
Organ: prostate
Tissue: BPH
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Gel-purification of HPL-RB4 to isolate clones with larger insertsize. Library constructed by Bob Barstead.


Name: NCI_CGAP_Pr1
Library ID: 381
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal prostate epithelium, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr10
Library ID: 466
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: invasive tumor
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from invasive prostate tumor, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr11
Library ID: 467
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: epithelial cells
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal prostatic epithelial cells, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr13
Library ID: 487
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: epithelial cells
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: average insert size 600 bp


Name: NCI_CGAP_Pr14
Library ID: 488
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: low PIN-preneoplastic lesion
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: average insert size 600 bp


Name: NCI_CGAP_Pr15
Library ID: 489
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: epithelial cells
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal prostate epithelial cells, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size- selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr16
Library ID: 490
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: invasive tumor
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from invasive prostate tumor cells, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr17
Library ID: 491
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: BPH, epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: average insert size 600 bp


Name: NCI_CGAP_Pr18
Library ID: 492
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: BPH, stroma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from prostate BPH, stroma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr19
Library ID: 493
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: stroma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: average insert size 600 bp


Name: NCI_CGAP_Pr2
Library ID: 382
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: intraepithelial premalignant neoplasia
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from preneoplastic intra-epithelial prostate neoplasia (low-grade), cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr21
Library ID: 503
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: bulk tissue
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from normal prostate bulk tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAGTGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is not normalized. (Normalized version of this library is named NCI_CGAP_Pr22.) Library was constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr22
Library ID: 504
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: bulk tissue
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from normal prostate bulk tissue, and was then primed with a Not I - oligo(dT) primer: 5'-TGTTACCAATCTGAAGTGGGAGCGGCCGCAAGTGTTTTTTTTTTTTTTTTTTTTTTTTT-3'; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library is normalized, and was constructed by Bento Soares and M. Fatima Bonaldo. (Non-normalized version of this library is named NCI_CGAP_Pr21. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr23
Library ID: 529
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: pooled tumors
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pooled prostate tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.2 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr24
Library ID: 601
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: invasive tumor cell line, HPV immortalized
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Invasive prostate tumor cell line (HPV immortalized). 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.0 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr25
Library ID: 602
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: epithelial cell line, HPV immortalized
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Normal prostate epithelial cell line (HPV immortalized). 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.1 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr28
Library ID: 1244
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: bulk tissue
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: Plasmid DNA from the normalized library NCI_CGAP_Pr22 was prepared, and ss circles were made in vitro. Following HAP purification, this DNA was used as tracer in a subtractive hybridization reaction. The driver was PCR-amplified cDNAs from a pool of 5,000 clones made from the same library (cloneIDs 985608-986759, 1101192-1101959, and 1217928-1220615). Subtraction by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr3
Library ID: 383
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: invasive epithelial tumor
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from invasive prostate tumor, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr4
Library ID: 384
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: intraepithelial neoplasia (high-grade)
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from prostate intraepithelial neoplasia (high-grade), cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr4.1
Library ID: 540
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: intraepithelial neoplasia (high-grade)
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from prostatic intraepithelial neoplasia (high-grade), cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr5
Library ID: 461
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: epithelial cells
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal prostatic epithelial cells, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr6
Library ID: 462
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: intraepithelial neoplasia (low-grade)
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from prostatic intraepithelial neoplasia (low-grade), cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr7
Library ID: 463
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: intraepithelial neoplasia (low grade)
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from prostate intraepithelial neoplasia (high-grade), cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr8
Library ID: 464
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: invasive tumor
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from invasive prostate tumor, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Pr9
Library ID: 465
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: epithelial cells
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal prostatic epithelial cells, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. cDNA Library Preparation: David B. Krizman, Ph.D. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1442
Organism: Homo sapiens
Gender: male
Age: 0
Organ: prostate
Tissue: normal epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal prostate epithelium, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1443
Organism: Homo sapiens
Gender: male
Age: 0
Organ: prostate
Tissue: carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from prostatic carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_111
Library ID: 1815
Organism: Homo sapiens
Gender: male
Age: 0
Organ: prostate
Tissue: prostate carcinoma, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_210
Library ID: 2216
Organism: Homo sapiens
Gender: male
Age: 0
Organ: prostate
Tissue: CNCAP(3)T-225 cell line
Host: DH10B TonA
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCCCACTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library was constructed by Bento Soares and M. Fatima Bonaldo (University of Iowa). Note: this is a NIH_MGC Library.


Name: NIH_MGC_40
Library ID: 1735
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: prostate
Tissue: prostate carcinoma, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_60
Library ID: 1588
Organism: Homo sapiens
Gender: male
Age: 0
Organ: prostate
Tissue: adenocarcinoma cell line
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.5 kb (range 0.9-4.0 kb). 14/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_83
Library ID: 1653
Organism: Homo sapiens
Gender: male
Age: 0
Organ: prostate
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.4 kb (range 0.5-4.0 kb). 14/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_91
Library ID: 1727
Organism: Homo sapiens
Gender: male
Age: 0
Organ: prostate
Tissue: adenocarcinoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.4 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.


Name: NCI_CGAP_Mel15
Library ID: 1350
Organism: Homo sapiens
Age: 0
Organ: skin
Tissue: malignant melanoma, metastatic to lymph node
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Skn1
Library ID: 1591
Organism: Homo sapiens
Age: 0
Organ: skin
Tissue: 4 pooled samples
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.03kb. Library constructed by Life Technologies, cat # 11132-018. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Skn3
Library ID: 1743
Organism: Homo sapiens
Age: 0
Organ: skin
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.5kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Skn4
Library ID: 1744
Organism: Homo sapiens
Age: 0
Organ: skin
Tissue: squamous cell carcinoma
Host: DH10B TonA
Vector: pCMV-SPORT6.ccdb
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.5kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_112
Library ID: 1816
Organism: Homo sapiens
Age: 0
Organ: skin
Tissue: melanotic melanoma, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_20
Library ID: 1430
Organism: Homo sapiens
Age: 0
Organ: skin
Tissue: melanotic melanoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_41
Library ID: 1736
Organism: Homo sapiens
Age: 0
Organ: skin
Tissue: melanoma, amelanotic, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_49
Library ID: 1707
Organism: Homo sapiens
Age: 0
Organ: skin
Tissue: melanotic melanoma, high MDR, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_62
Library ID: 1590
Organism: Homo sapiens
Age: 0
Organ: skin
Tissue: melanotic melanoma, high MDR, cell line
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.75 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_72
Library ID: 1621
Organism: Homo sapiens
Age: 0
Organ: skin
Tissue: melanotic melanoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library.

Soares 2NbHM

Name: Soares 2NbHM
Library ID: 188
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: skin
Tissue: melanocyte
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' AACTGGAAGAATTCGCGGCCGCAGTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.


Name: NIH_MGC_88
Library ID: 1714
Organism: Homo sapiens
Age: 0
Organ: small intestine
Tissue: duodenum, adenocarcinoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 1.767 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.


Name: NCI_CGAP_Lei2
Library ID: 794
Organism: Homo sapiens
Age: 0
Organ: soft tissue
Tissue: leiomyosarcoma, 2 pooled
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' AACTGGAAGAATTCGCGGCCGCAATCGTTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo. Note: this is a NCI_CGAP Library.

Barstead HPL-RB2

Name: Barstead HPL-RB2
Library ID: 720
Organism: Homo sapiens
Gender: male
Age: 17
Stage: adult
Organ: spleen
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [AATTCGGATCCATC and CATGGATCCG], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Life Tech spleen (10425-015)

Name: Life Tech spleen (10425-015)
Library ID: 111
Organism: Homo sapiens
Gender: female
Age: 42
Stage: adult
Organ: spleen
Host: DH12S
Vector: pCMV-SPORT
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: directionally cloned, average insert size 1.41 kb


Name: NIH_MGC_113
Library ID: 1757
Organism: Homo sapiens
Age: 0
Organ: spleen
Tissue: normal spleen tissue
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.

Stratagene fetal spleen (937205)

Name: Stratagene fetal spleen (937205)
Library ID: 62
Organism: Homo sapiens
Gender: both
Age: 0
Stage: fetal
Organ: spleen
Tissue: 2 pooled
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pooled spleens. Average insert size: 1.0 kb; Uni-ZAP XR Vector; ~5' adaptor sequence: 5' GAATTCGGCACGAG 3' ~3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3'


Name: NCI_CGAP_Gas1
Library ID: 530
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: stomach
Tissue: pooled tumors
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Pooled gastric tumors. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.0 kb. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Gas4
Library ID: 1276
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: stomach
Tissue: poorly differentitated adenocarcinoma with signet ring cell features
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.69 kb. Life Technologies catalog #: 11549-011 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_St3
Library ID: 2041
Organism: Homo sapiens
Age: 0
Organ: stomach
Tissue: adenocarcinoma
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.30 kb (range 0.60-3.5 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_242
Library ID: 2148
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: XL10 Gold
Vector: pUC19
Vector type: plasmid
Insert digest: SmaI
Stop Codon Status: without
Description: Clones from this library are synthetic, full-ORF constructs, prepared and donated by A. Madan, PhD (University of Iowa).


Name: NIH_MGC_243
Library ID: 2149
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: TOP10
Vector: pCR-BluntII-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones from this library are synthetic, full-ORF constructs, prepared and donated by A. Madan, PhD (University of Iowa).


Name: NIH_MGC_369
Library ID: 2362
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: DH10B TonA
Vector: pENTR223.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: with
Description: This library is a part of a collection of full-length cDNA clones generated by Mammalian Gene Collection project. DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-GGCCTCATGGgcccagctttcttg-3'. Clones were synthesized by Codon Devices Inc (Cambridge, MA). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_370
Library ID: 2363
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: DH10B TonA
Vector: pENTR223.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without
Description: This library is a part of a collection of full-length cDNA clones generated by Mammalian Gene Collection project. DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-GGCCTCATGGgcccagctttcttg-3'. Clones were synthesized by Genscript Corp (Piscataway, NJ). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_371
Library ID: 2364
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: DH10B TonA
Vector: pENTR223.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without
Description: This library is a part of a collection of full-length cDNA clones generated by Mammalian Gene Collection project. DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-GGCCTCATGGgcccagctttcttg-3'. Clones were synthesized by Picoscript Ltd, LLP (Houston, TX). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_372
Library ID: 2365
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: EC100 T1-resistant
Vector: pENTR223.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without
Description: This library is a part of a collection of full-length cDNA clones generated by Mammalian Gene Collection project. DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-GGCCTCATGGgcccagctttcttg-3'. Clones were synthesized by Blue Heron Biotechnology Inc (Bothell, WA). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_425
Library ID: 2481
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: DH10B TonA
Vector: pENTR223.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without
Description: DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TCAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Clones were synthesized by GENEART AG (Regensburg, Germany). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.


Name: NIH_MGC_428
Library ID: 2484
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: DH10B TonA
Vector: pENTR223.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: with
Description: DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TAAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Clones were synthesized by GENEART AG (Regensburg, Germany). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.


Name: NIH_MGC_435
Library ID: 2491
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: DH10B TonA
Vector: pENTR223.1
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: with
Description: DNA synthesis was used to prepare the protein coding sequence (ORF) and flanking sequences, permitting directional cloning into the Gateway Entry vector, pENTR223.1 (recombinational cloning details are described in Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcagaagGGCCGTCAAGGCCCACC-ORF-TAAGGCCTCATGGgcccagctttcttg-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Clones were synthesized by Codon Devices (Cambridge, MA). Note: library donated to the ORFeome Collaboration by the Mammalian Gene Collection.


Name: NIH_MGC_479
Library ID: 2506
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: DH10B
Vector: pSMART_cDNA
Vector type: plasmid
Insert digest: multiple
Stop Codon Status: without


Name: NIH_MGC_480
Library ID: 2508
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: DH10B
Vector: pUC19-Kan
Vector type: plasmid
Insert digest: multiple
Stop Codon Status: without


Name: NIH_MGC_481
Library ID: 2507
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: DH10B
Vector: pUC19
Vector type: plasmid
Insert digest: multiple
Stop Codon Status: without


Name: NIH_MGC_486
Library ID: 2512
Organism: Homo sapiens
Age: 0
Organ: synthesized DNA
Host: DH10B
Vector: pUC19-Sfi
Vector type: plasmid
Insert digest: multiple
Stop Codon Status: without


Name: NIH_MGC_191
Library ID: 2039
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: T-cell
Tissue: Peripheral Blood Mononuclear Cells (PBMC), pooled
Host: DH10B TonA
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned. PBMC - Peripheral Blood Mononuclear Cells. RNA was pooled from 3/6 hour stimulation with PMA and Ionomycin. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.69 kb (range 0.70-5.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.

Barstead HPL-RB5

Name: Barstead HPL-RB5
Library ID: 1061
Organism: Homo sapiens
Gender: male
Age: 67
Stage: adult
Organ: testis
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACGAATCTGAAGTGGGAGCGGCCGCCCTTTTTTTTTTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors [5' AATTCGGATCCAAG 3' and 5' CTTGGATCCG 3'], digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library constructed by R. Barstead (Oklahoma Medical Research Foundation).

Life Tech testis (10426-013)

Name: Life Tech testis (10426-013)
Library ID: 108
Organism: Homo sapiens
Gender: male
Age: 60
Stage: adult
Organ: testis
Host: DH12S
Vector: pCMV-SPORT
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Caucasian. Average insert size: 1.56 kb; pCMV-SPORT vector.


Name: NIH_MGC_180
Library ID: 2025
Organism: Homo sapiens
Age: 0
Organ: testis
Host: DH10B TonA
Vector: pCMV-SPORT6.1
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed and directionally cloned (EcoRV site is destroyed upon cloning). Average insert size 1.68 kb. Library was constructed by Invitrogen. Note: this is a NIH_MGC Library.


Name: NIH_MGC_267
Library ID: 2173
Organism: Homo sapiens
Gender: male
Age: 48
Stage: adult
Organ: testis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_275 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_275
Library ID: 2207
Organism: Homo sapiens
Gender: male
Age: 48
Stage: adult
Organ: testis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_267 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_373
Library ID: 2388
Organism: Homo sapiens
Gender: male
Age: 0
Organ: testis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PmeI site and the 3' end nearest the NotI site. Companion library NIH_MGC_374 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_374
Library ID: 2389
Organism: Homo sapiens
Gender: male
Age: 0
Organ: testis
Host: DH10B TonA
Vector: pCR4-TOPO
Vector type: plasmid
Insert digest: TOPO sites
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR4-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the NotI site and the 3' end nearest the PmeI site. Companion library NIH_MGC_373 has clones in the opposite orientation. Every submitted sequence starts with the vector sequence (GAATTCGCCCTT) and ends with the vector sequence (AAGGGCGAATTC). Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_375
Library ID: 2390
Organism: Homo sapiens
Gender: male
Age: 0
Organ: testis
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the SpeI site and the 3' end nearest the PstI site. Companion library NIH_MGC_376 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_376
Library ID: 2391
Organism: Homo sapiens
Gender: male
Age: 0
Organ: testis
Host: DH10B TonA
Vector: pCR-XL-TOPO
Vector type: plasmid
Insert digest: EcoRI
Stop Codon Status: without
Description: Clones were individually RT-PCR'd using primers directed against full-length RefSeq sequences. PCR products were TA-cloned into the pCR-XL-TOPO vector and inserts can be digested using EcoRI alone. Clones are oriented with the 5' end nearest the PstI site and the 3' end nearest the SpeI site. Companion library NIH_MGC_375 has clones in the opposite orientation. Library constructed and clones sequenced by the BCCA Genome Sciences Centre (Vancouver, Canada). Note: this is a Mammalian Gene Collection library.


Name: NIH_MGC_61
Library ID: 1589
Organism: Homo sapiens
Gender: male
Age: 0
Organ: testis
Tissue: embryonal carcinoma cell line
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: Double-stranded cDNA was prepared from cell line RNA. 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.75 kb (range 0.9-4.0 kb). 15/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_82
Library ID: 1645
Organism: Homo sapiens
Gender: male
Age: 0
Organ: testis
Host: GeneHogs DH10B
Vector: pDNR-LIB
Vector type: plasmid
Insert digest: SfiI (directional)
Stop Codon Status: without
Description: 5'' and 3'' adaptors were used in cloning as follows: 5'' adaptor sequence: 5''-CACGGCCATTATGGCC-3'' and 3'' adaptor sequence: 5''-ATTCTAGAGGCCGAGGCGGCCGACATG-dT(30)BN-3'' (where B = A, C, or G and N = A, C, G, or T). Average insert size 1.35 kb (range 0.9-4.0 kb). 14/15 colonies contained inserts by PCR. This library was enriched for full-length clones and was constructed by Clontech Laboratories (Palo Alto, CA). Note: this is a NIH_MGC Library.


Name: NIH_MGC_92
Library ID: 1728
Organism: Homo sapiens
Gender: male
Age: 0
Organ: testis
Tissue: embryonal carcinoma, cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally; oligo-dT primed. Average insert size 2.5 kb. Library enriched for full-length clones and constructed by Life Technologies. Note: this is a NIH_MGC Library.


Name: NIH_MGC_97
Library ID: 1709
Organism: Homo sapiens
Gender: male
Age: 0
Organ: testis
Host: DH10B
Vector: pBluescriptR
Vector type: phagemid
Insert digest: 5' SalI-XhoI/BamHI 3'
Stop Codon Status: without
Description: Oligo-dT primed using primer 5''-TTTTTTTTTTTTTTTTVN-3'', size-selected for average insert size 2.2 kb and normalized to ROT 5. This is a primary library enriched for full-length clones and constructed using the Cap-trapper method (Carninci, in preparation). Library constructed by M. Brownstein (NIMH/NHGRI, National Institutes of Health). Note: this is a NIH_MGC Library.

Soares NHT

Name: Soares NHT
Library ID: 371
Organism: Homo sapiens
Gender: male
Age: 0
Stage: adult
Organ: testis
Host: DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was prepared from mRNA obtainedfrom Clontech Laboratories, Inc., and primed with a Not I - oligo(dT) primer [5' TGTTACCAATCTGAAGTGGGAGCGGCCGCCAATTTTTTTTTTTTTTTTT 3']; double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization to Cot5, and was constructed by Bento Soares and M. Fatima Bonaldo.


Name: NCI_CGAP_Thym1
Library ID: 611
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: thymus
Tissue: thymoma
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Thymoma. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' CTCGAGTTTTTTTTTTTTTTTTTT 3' Average insert size: 1.0 kb. Note: this is a NCI_CGAP Library.

Soares NHFTh

Name: Soares NHFTh
Library ID: 1338
Organism: Homo sapiens
Age: 0
Stage: fetal
Organ: thymus
Host: GeneHogs DH10B
Vector: pT7T3D-PacI
Vector type: plasmid
Insert digest: 5' EcoRI/NotI 3'
Stop Codon Status: without
Description: 1st strand cDNA was primed with a Not I - oligo(dT) primer[5' TGTTACCAATCTGAAGTGGGAGCGGCCGCAACGTTTTTTTTTTTTTTTTTT 3'], double-stranded cDNA was ligated to EcoRI adaptors 5'-AATTCGGCACGAGG-3' and 5'-CCTCGTGCCG-3' (Pharmacia), digested with NotI and cloned into the NotI and EcoRI sites of the pT7T3D-PacI vector. Library went through one round of normalization. Library constructed by Bento Soares and M. Fatima Bonaldo.


Name: NCI_CGAP_Thy1
Library ID: 472
Organism: Homo sapiens
Age: 0
Stage: adult
Organ: thyroid
Tissue: invasive tumor
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from invasive thyroid tumor, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 600 bp. Library made by D. Krizman, NIH. Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Thy10
Library ID: 1450
Organism: Homo sapiens
Age: 0
Organ: thyroid
Tissue: medullary carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from thyroid carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Thy11
Library ID: 1528
Organism: Homo sapiens
Age: 0
Organ: thyroid
Tissue: follicular carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from thyroid carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Thy12
Library ID: 1529
Organism: Homo sapiens
Age: 0
Organ: thyroid
Tissue: papillary carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from thyroid carcinoma, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Thy3
Library ID: 1464
Organism: Homo sapiens
Age: 0
Organ: thyroid
Tissue: follicular carcinoma
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.4 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Thy4
Library ID: 1444
Organism: Homo sapiens
Age: 0
Organ: thyroid
Tissue: normal epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal thyroid epithelium, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Thy5
Library ID: 1445
Organism: Homo sapiens
Age: 0
Organ: thyroid
Tissue: follicular adenoma (benign lesion)
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from thyroid adenoma (benign), cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Thy6
Library ID: 1446
Organism: Homo sapiens
Age: 0
Organ: thyroid
Tissue: normal epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal thyroid epithelium, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Thy7
Library ID: 1447
Organism: Homo sapiens
Age: 0
Organ: thyroid
Tissue: follicular adenoma (benign lesion)
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from thyroid adenoma (benign), cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Thy8
Library ID: 1448
Organism: Homo sapiens
Age: 0
Organ: thyroid
Tissue: normal epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from normal thyroid epithelium, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Thy9
Library ID: 1449
Organism: Homo sapiens
Age: 0
Organ: thyroid
Tissue: anaplastic carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without


Library ID: 1388
Organism: Homo sapiens
Age: 0
Organ: tongue
Tissue: normal squamous epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1389
Organism: Homo sapiens
Age: 0
Organ: tongue
Tissue: moderate to poorly differentiated invasive carcinoma
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Non-directionally cloned into the UDG sites of pAMP10. Size-selected on agarose gel, average insert size 500 bp. Primary library; non-amplified. cDNA Library Preparation: David B. Krizman, Ph.D (NCI). Reference: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 1468
Organism: Homo sapiens
Age: 0
Organ: tongue
Tissue: squamous cell carcinoma
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.3 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Library ID: 1459
Organism: Homo sapiens
Age: 0
Organ: tongue
Tissue: hyperplasia of squamous epithelium
Host: DH10B
Vector: pAMP10
Vector type: phagemid
Insert digest: UDG
Stop Codon Status: without
Description: mRNA made from tongue epithelium, cDNA made by oligo-dT priming. Non-directionally cloned into UDG sites. Size-selected on agarose gel, average insert size 500 bp. Primary library. cDNA Library Preparation: David B. Krizman, Ph.D. REFERENCE: Krizman et al. (1996) Cancer Research 56:5380-5383. Note: this is a NCI_CGAP Library.


Library ID: 764
Organism: Homo sapiens
Age: 0
Organ: tongue
Tissue: squamous cell carcinoma from base of tongue
Host: SOLR
Vector: pBluescript SK-
Vector type: phagemid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.0 kb. 5' adaptor sequence: 5' GAATTCGGCACGAG 3' 3' adaptor sequence: 5' (GA)10ACTAGTCTCGAGTTTTTTTTTTTTTTTTTT 3' Library constructed by Stratagene. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_173
Library ID: 2033
Organism: Homo sapiens
Age: 0
Organ: trophoblast
Tissue: trophoblast
Host: DH10B TonA
Vector: pDONR201
Vector type: plasmid
Insert digest: 5' attP2/attP1
Stop Codon Status: without
Description: cDNA made by oligo-dT with attB2 site and directionally cloned. Priming sequence: 5'-TTTCCTGCAGGCCGGCCACCACTTTGTACAAGAAAGCTGGGTTTTTTTTTTTTTTTTTTT-3'. Full-length enriched library was constructed using the GeneRacer kit by Invitrogen, library amplification 16 cycles. Library constucted by Mark Bittinger in the Bradfield laboratory (McArdle Laboratory for Cancer Research, University of Wisconsin). Note: this is a NIH_MGC Library.


Name: NIH_MGC_194
Library ID: 2043
Organism: Homo sapiens
Gender: both
Age: 0
Organ: trophoblast
Tissue: trophoblast
Host: DH10B TonA
Vector: pCI-neo (updated)
Vector type: plasmid
Insert digest: 5' AscI/PacI 3'
Stop Codon Status: without
Description: Constructed by Gina Zastrow using the Bradfield Laboratory RACE method (University of Wisconsin). Note: this is a NIH_MGC Library.

CCSB-DFCI hORFeome collection

Name: CCSB-DFCI hORFeome collection
Library ID: 2538
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pDONR223
Vector type: plasmid
Insert digest: 5' attB1.1/attB2.1 3'
Stop Codon Status: without
Description: Full open reading frame clones were created in the Gateway system by the Center for Cancer Systems Biology (CCSB) at DFCI, M. Vidal director, (reference Genome Res. 2004 Oct;14(10B):2128-35 and Genomics 2007 Mar;89(3):307-15) using MGC clones as templates. For PCR amplification, both forward and reverse ORF-specific primers for each MGC clone were designed automatically using the OSP program (Hillier and Green 1991). The forward primer starts from A of the ATG initiation codon, whereas the reverse primer starts from the second nucleotide of the termination codon. The reverse attB2.1 primers do not contain the last nucleotide of the termination codon, so as to allow generation of C-terminal fusion proteins. This library is specifically made of single colonies isolated from the transformed ORF pools. Clones were prepared by the M. Vidal laboratory (Dana Farber Cancer Institute) and generously donated for use by the ORFeome Collaboration.


Name: DFCI-Kazusa.orf
Library ID: 2463
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pDONR223
Vector type: plasmid
Insert digest: 5' attL1.1/attL2.1 3'
Stop Codon Status: without
Description: Clones from the Kazusa DNA Research Institute were generously donated for use as the starting template. 8 ul of each clone was inoculated in 1 ml LB containing the appropriate antibiotic. A BP recombinational reaction contains 2 ul of 5 X BP3 buffer; 2 ul of BP clonase; 1 ul of pDONR223 (150 ng/uL); 2 ul of PCR product (2-200 ng/uL); 3 uL H2O. The 5 X BP3 buffer consists of 100 mM Tris-Cl (pH 7.5); 20 mM EDTA; 30 mM spermidine-HCL; 25 percent glycerol; 225 mM NaCl. LR reactions we performed as described previously with minor changes (Reboul et al. 2003, Rual et al. 2004). BP products were transformed into liquid cultures of E. coli, with antibiotic selection of spectinomycin at 50 ug/mL. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGCACC-ORF-TTGccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Dana Farber Cancer Institute, Center for Cancer Systems Biology for the ORFeome Collaboration.


Name: DFCI-RIKEN.orf
Library ID: 2464
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pDONR223
Vector type: plasmid
Insert digest: 5' attL1.1/attL2.1 3'
Stop Codon Status: without
Description: Clones from the Genomic Sciences Center at RIKEN Yokohama Institute were generously donated for use as the starting template. 8 ul of each clone was inoculated in 1 ml LB containing the appropriate antibiotic. A BP recombinational reaction contains 2 ul of 5 X BP3 buffer; 2 ul of BP clonase; 1 ul of pDONR223 (150 ng/uL); 2 ul of PCR product (2-200 ng/uL); 3 uL H2O. The 5 X BP3 buffer consists of 100 mM Tris-Cl (pH 7.5); 20 mM EDTA; 30 mM spermidine-HCL; 25 percent glycerol; 225 mM NaCl. LR reactions we performed as described previously with minor changes (Reboul et al. 2003, Rual et al. 2004). BP products were transformed into liquid cultures of E. coli, with antibiotic selection of spectinomycin at 50 ug/mL. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGCACC-ORF-TTGccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Dana Farber Cancer Institute, Center for Cancer Systems Biology for the ORFeome Collaboration.


Name: DKFZo001
Library ID: 2460
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR201
Vector type: Gateway entry vector
Insert digest: 5' attB_N/attB_C 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagctggcaCC-ORF-GGCGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo002
Library ID: 2461
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR201
Vector type: Gateway entry vector
Insert digest: 5' attB_N/attB_C 3'
Stop Codon Status: with
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagctggcaCC-ORF-GGCGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo003
Library ID: 2452
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attB_neu_N/attB_hind2_C- 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-AAGCTTGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo004
Library ID: 2453
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attB_neu_N/attB_bam_C+ 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGGATCCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo005
Library ID: 2454
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attB_neu_N/attB_eco_C- 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGTATTCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo006
Library ID: 2462
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attB_N/attB_C 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagctggcaCC-ORF-GGCGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo007
Library ID: 2455
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attB_neu_N/attB_hind2_C+ 3'
Stop Codon Status: with
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TAGCTTGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo008
Library ID: 2456
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attB_neu_N/attB_bam_C- 3'
Stop Codon Status: with
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGAATCCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo009
Library ID: 2457
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attB_neu_N/attB_eco_C+ 3'
Stop Codon Status: with
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGAATTCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo010
Library ID: 2458
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR/D-TOPO
Vector type: Gateway entry vector
Insert digest: 5' topo5_neu/topo3 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCGCGGCCGCCCCCTTCACC-ORF-AAGGGTGGGCGCGCCGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo011
Library ID: 2528
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attB_neu_N/attB_hind_C- 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGAATCCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo012
Library ID: 2529
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attB_neu_N/attB_hind_C+ 3'
Stop Codon Status: with
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGAATCCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo013
Library ID: 2530
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR223
Vector type: Gateway entry vector
Insert digest: 5' attB_neu_N/attB_bam_C- 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCGCGGCCGCCCCCTTCACC-ORF-AAGGGTGGGCGCGCCGacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: DKFZo014
Library ID: 2531
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B TonA
Vector: pENTR223
Vector type: Gateway entry vector
Insert digest: 5' attB_neu_N/attB_bam_C+ 3'
Stop Codon Status: with
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TGAATCCacccagctttcttgtaca-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed in the laboratory of Dr. Stefan Wiemann at the DKFZ German Cancer Research Center for the ORFeome Collaboration.


Name: HIP_Gateway201_closed
Library ID: 2495
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pENTR201
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without


Name: HIP_Gateway201_fusion
Library ID: 2494
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pENTR201
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: with


Name: HIP_Gateway221_closed
Library ID: 2497
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: with


Name: HIP_Gateway221_fusion
Library ID: 2496
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without

hORFeome v.3.1

Name: hORFeome v.3.1
Library ID: 2441
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pENTR223
Vector type: Gateway entry vector
Insert digest: 5' attL1.1/attL2.1 3'
Stop Codon Status: without
Description: Full-length Mammalian Gene Collection clones were used as the starting template. 8 ul of each clone was inoculated in 1 ml LB containing the appropriate antibiotic. A BP recombinational reaction contains 2 ul of 5 X BP3 buffer; 2 ul of BP clonase; 1 ul of pDONR223 (150 ng/uL); 2 ul of PCR product (2-200 ng/uL); 3 uL H2O. The 5 X BP3 buffer consists of 100 mM Tris-Cl (pH 7.5); 20 mM EDTA; 30 mM spermidine-HCL; 25 percent glycerol; 225 mM NaCl. LR reactions we performed as described previously with minor changes (Reboul et al. 2003, Rual et al. 2004). BP products were transformed into liquid cultures of E. coli, with antibiotic selection of spectinomycin at 50 ug/mL. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGC-ORF-TRCccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Dana Farber Cancer Institute, Center for Cancer Systems Biology for the ORFeome Collaboration.


Name: Kazusa-KIAA-pBCSK+
Library ID: 2470
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pBC SK+
Vector type: phagemid
Insert digest: 5' HindIII/SacI 3'
Stop Codon Status: without
Description: cDNA clones were generated and graciously donated by the Kazusa DNA Research Institute to the Mammalian Gene Collection.


Name: Kazusa-KIAA-pBluescriptIISK+
Library ID: 2465
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pBluescript II SK+
Vector type: phagemid
Insert digest: multiple
Stop Codon Status: without
Description: cDNA clones were generated as described in DNA Research 4:53-59. Cloning sites vary by clone and are listed here. Clones graciously donated by the Kazusa DNA Research Institute to the Mammalian Gene Collection.


Name: NIH_MGC_403
Library ID: 2467
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TTGGacccagctttcttgtac-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed at the Harvard Institute of Proteomics for the Mammalian Gene Collection.


Name: NIH_MGC_404
Library ID: 2466
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pENTR221
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TAGGacccagctttcttgtac-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed at the Harvard Institute of Proteomics for the Mammalian Gene Collection.


Name: NIH_MGC_405
Library ID: 2469
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pENTR201
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TTGGacccagctttcttgtac-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed at the Harvard Institute of Proteomics for the Mammalian Gene Collection.


Name: NIH_MGC_406
Library ID: 2468
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pENTR201
Vector type: Gateway entry vector
Insert digest: 5' attL1/attL2 3'
Stop Codon Status: without
Description: Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagcaggctCCACC-ORF-TAGGacccagctttcttgtac-3' where lower case corresponds to the att sites (partial) and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed at the Harvard Institute of Proteomics for the Mammalian Gene Collection.


Name: NIH_MGC_417
Library ID: 2459
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5a
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: This library was picked from the Novartis FGA collection, the accumulation of a number of libraries made over several years in pCMV-SPORT6. It is possible that one or more clones have minor modifications around the cloning site of this vector. The primer that has been used for 5' end reads is 5'-CAGGAAACAGCTATGACC-3'. Clones were made and graciously donated to the Mammalian Gene Collection by the Novartis Institute for Biomedical Research (Cambridge, MA).


Name: NIH_MGC_422
Library ID: 2471
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pDNR-Dual
Vector type: plasmid
Insert digest: 5' loxP-SalI/HindIII-loxP 3'
Stop Codon Status: without
Description: Clones from this library do contain a stop codon. Library constructed at the Harvard Institute of Proteomics for the Mammalian Gene Collection.


Name: NIH_MGC_423
Library ID: 2472
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH5alpha T1-resistant
Vector: pDNR-Dual
Vector type: plasmid
Insert digest: 5' loxP-SalI/HindIII-loxP 3'
Stop Codon Status: without
Description: Clones from this library do not contain a stop codon. Library constructed at the Harvard Institute of Proteomics for the Mammalian Gene Collection.


Name: NIH_MGC_424
Library ID: 2473
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: DH10B
Vector: pFLC1
Vector type: phagemid
Insert digest: 5' SalI-XhoI/BamHI 3'
Stop Codon Status: without
Description: cDNA library was constructed using the CAP-trapper method as described in Genomics 37:327-336 and graciously donated by the RIKEN Genomic Sciences Center for the Mammalian Gene Collection.


Name: WTSI-chORF
Library ID: 2422
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: Mach1 T1-resistant
Vector: pENTR223
Vector type: Gateway entry vector
Insert digest: 5' attL1.1/attL2.1 3'
Stop Codon Status: with
Description: ORFs flanked by att sites were amplified from fully sequence verified cDNA clones in two rounds of PCR. Amplified products were separated by agarose gel electrophoresis, excised, purified and recombined into pDONR223 using BP clonase TM. After full sequence verification, only clones which exactly matched the original cDNA and att sequences were accepted. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGCACC-ORF-ccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do contain a stop codon. Library constructed by the Wellcome Trust Sanger Institute for the ORFeome Collaboration.


Name: WTSI-ohORF
Library ID: 2423
Organism: Homo sapiens
Age: 0
Organ: unspecified
Host: Mach1 T1-resistant
Vector: pENTR223
Vector type: Gateway entry vector
Insert digest: 5' attL1.1/attL2.1 3'
Stop Codon Status: without
Description: ORFs flanked by att sites were amplified from fully sequence verified cDNA clones in two rounds of PCR. Amplified products were separated by agarose gel electrophoresis, excised, purified and recombined into pDONR223 using BP clonase TM. After full sequence verification, only clones which exactly matched the original cDNA and att sequences were accepted. Clone structure of the ORF and flanking sequences is as follows: 5'-gtacaaaaaagttgGCACC-ORF-ccaactttcttgtac-3' where lower case corresponds to the att sites and upper case corresponds to linker sequence. Clones from this library do not contain a stop codon. Library constructed by the Wellcome Trust Sanger Institute for the ORFeome Collaboration.


Name: NCI_CGAP_Ut1
Library ID: 1269
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: uterus
Tissue: well-differentiated endometrial adenocarcinoma, 7 pooled tumors
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.75 kb. Life Technologies catalog #: 11538-014 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ut2
Library ID: 1270
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: uterus
Tissue: moderately differentiated endometrial adenocarcinoma, 3 pooled tumors
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.85 kb. Life Technologies catalog #: 11539-012 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ut3
Library ID: 1271
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: uterus
Tissue: poorly differentiated endometrial adenocarcinoma, 2 pooled tumors
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.45 kb. Life Technologies catalog #: 11541-018 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ut4
Library ID: 1272
Organism: Homo sapiens
Gender: female
Age: 0
Stage: adult
Organ: uterus
Tissue: serous papillary carcinoma, high grade, 2 pooled tumors
Host: DH10B
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.48 kb. Life Technologies catalog #: 11542-016 Note: this is a NCI_CGAP Library.


Name: NCI_CGAP_Ut7
Library ID: 1470
Organism: Homo sapiens
Gender: female
Age: 0
Organ: uterus
Tissue: tumor
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 1.2 kb. Library constructed by Life Technologies. Note: this is a NCI_CGAP Library.


Name: NIH_MGC_44
Library ID: 1572
Organism: Homo sapiens
Gender: female
Age: 0
Organ: uterus
Tissue: endometrium adenocarcinoma, cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_46
Library ID: 1654
Organism: Homo sapiens
Age: 0
Organ: uterus
Tissue: leiomyosarcoma cell line
Host: GeneHogs DH10B
Vector: pOTB7
Vector type: plasmid
Insert digest: 5' EcoRI/XhoI 3'
Stop Codon Status: without
Description: cDNA made by oligo-dT priming. Directionally cloned into EcoRI/XhoI sites using the following 5'' adaptor: GGCACGAG(G). Size-selected >500bp for average insert size 1.8kb. Library constructed by Ling Hong in the laboratory of Gerald M. Rubin (University of California, Berkeley) using ZAP-cDNA synthesis kit (Stratagene) and Superscript II RT (Life Technologies). Note: this is a NIH_MGC Library.


Name: NIH_MGC_71
Library ID: 1620
Organism: Homo sapiens
Gender: female
Age: 0
Organ: uterus
Tissue: leiomyosarcoma cell line
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Cloned unidirectionally. Primer: Oligo dT. Average insert size 2.1 kb. Library constructed by Life Technologies. Note: this is a NIH_MGC Library.