cow (Bos taurus) cDNA Library Information

  Boolean search type:

Instructions: Enter search term(s) and/or number range(s) to search in ORFeome Collaboration Collections: OCAA, OCAB, hORFeome V8.1 (species: human).   Detailed Instructions...

Information for 28 libraries (by tissue)


   1. GC_BGC-11
   2. GC_BGC-18
   3. GC_BGC-19
   4. GC_BGC-20
   5. GC_BGC-21
   6. GC_BGC-22
   7. GC_BGC-25
   8. GC_BGC-26
   9. GC_BGC-27
   10. GC_BGC-28


   11. GC_BGC-17


   12. GC_BGC-12


   13. GC_BGC-02


   14. GC_BGC-34


   15. GC_BGC-04
   16. GC_BGC-14


   17. GC_BGC-23

mammary gland

   18. GC_BGC-03


   19. GC_BGC-30


   20. GC_BGC-33


   21. GC_BGC-24

Peyer's patch

   22. GC_BGC-01


   23. GC_BGC-32


   24. GC_BGC-35


   25. GC_BGC-29


   26. GC_BGC-05


   27. GC_BGC-13


   28. GC_BGC-16


Name: GC_BGC-11
Library ID: 2309
Organism: Bos taurus
Strain: Hereford
Gender: female
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: hypothalamus
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400 bp with average size 1.4 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-18
Library ID: 2360
Organism: Bos taurus
Strain: Hereford
Gender: male
Age: 0
Stage: fetal
Organ: brain/CNS
Tissue: cerebral cortex
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.3 kp and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-19
Library ID: 2318
Organism: Bos taurus
Strain: Hereford
Gender: male
Age: 0
Stage: fetal
Organ: brain/CNS
Tissue: pons
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.5 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-20
Library ID: 2319
Organism: Bos taurus
Strain: Hereford
Gender: male
Age: 0
Stage: fetal
Organ: brain/CNS
Tissue: medulla
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.3 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-21
Library ID: 2361
Organism: Bos taurus
Strain: Hereford
Gender: male
Age: 0
Stage: fetal
Organ: brain/CNS
Tissue: spinal column
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.3 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-22
Library ID: 2320
Organism: Bos taurus
Strain: Hereford
Gender: male
Age: 0
Stage: fetal
Organ: brain/CNS
Tissue: cerebellum
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.4 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-25
Library ID: 2338
Organism: Bos taurus
Strain: L1 Hereford
Gender: female
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: hippocampus
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 2 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.


Name: GC_BGC-26
Library ID: 2339
Organism: Bos taurus
Strain: L1 Hereford
Gender: female
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: thalamus
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 2.2 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.


Name: GC_BGC-27
Library ID: 2340
Organism: Bos taurus
Strain: L1 Hereford
Gender: female
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: basal ganglia
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.8 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.


Name: GC_BGC-28
Library ID: 2341
Organism: Bos taurus
Strain: L1 Hereford
Gender: female
Age: 0
Stage: juvenile
Organ: brain/CNS
Tissue: cerebral cortex
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 1.9 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.


Name: GC_BGC-17
Library ID: 2314
Organism: Bos taurus
Strain: L1 Hereford
Gender: male
Age: 0
Stage: fetal
Organ: colon
Tissue: ascending colon
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 2.3kb. This is a non-normalized primary library and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.


Name: GC_BGC-12
Library ID: 2311
Organism: Bos taurus
Strain: Hereford
Gender: female
Age: 0
Stage: juvenile
Organ: heart
Tissue: ventricle
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400bp with average size 1.4 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-02
Library ID: 2256
Organism: Bos taurus
Strain: Crossbred x Angus
Gender: female
Age: 0
Stage: juvenile
Organ: ileum
Host: XL10 Gold
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >300 bp with average size 1120 bp and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-34
Library ID: 2410
Organism: Bos taurus
Strain: Hereford
Gender: female
Age: 0
Stage: juvenile
Organ: kidney
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.1kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-04
Library ID: 2304
Organism: Bos taurus
Strain: Crossbred x Angus
Gender: female
Age: 0
Stage: juvenile
Organ: liver
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400 bp with average size 1 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-14
Library ID: 2312
Organism: Bos taurus
Strain: Hereford
Gender: male
Age: 0
Stage: fetal
Organ: liver
Tissue: liver
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400 bp with average size 1.8 bp and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-23
Library ID: 2321
Organism: Bos taurus
Strain: Hereford
Gender: male
Age: 0
Stage: fetal
Organ: lung
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-03
Library ID: 2259
Organism: Bos taurus
Strain: Hereford
Gender: female
Age: 4
Stage: adult
Organ: mammary gland
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400 bp with average size 1300 bp and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-30
Library ID: 2343
Organism: Bos taurus
Strain: L1 Hereford
Gender: male
Age: 0
Stage: fetal
Organ: muscle
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 2.2 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.


Name: GC_BGC-33
Library ID: 2382
Organism: Bos taurus
Strain: Hereford
Gender: female
Age: 0
Stage: juvenile
Organ: ovary
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.2 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-24
Library ID: 2381
Organism: Bos taurus
Strain: Hereford
Gender: male
Age: 0
Stage: fetal
Organ: pancreas
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.1 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-01
Library ID: 2221
Organism: Bos taurus
Strain: Crossbred x Angus
Gender: female
Age: 0
Stage: juvenile
Organ: Peyer's patch
Host: DH10B TonA
Vector: pBluescript II SK+
Vector type: phagemid
Insert digest: 5' XhoI/BamHI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using BamHI primer 5'-GAGAGAGAGAAAGGATCCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using XhoI primer 5'-GAGAGAGAGAGAGATTCTTCGAGTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pBluescript II SK+ vector. Library is size selected >400 bp with average size 890 bp and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (3') and M13F (5'). Library constructed by J. Yu and S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-32
Library ID: 2375
Organism: Bos taurus
Strain: Hereford
Gender: neither
Age: 0
Stage: placental
Organ: placenta
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.5 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-35
Library ID: 2411
Organism: Bos taurus
Strain: Hereford
Gender: female
Age: 0
Stage: juvenile
Organ: Rumen
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAGAGAGAAGCGGCCGCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >500 bp with average size 1.1kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-29
Library ID: 2342
Organism: Bos taurus
Strain: L1 Hereford
Gender: male
Age: 0
Stage: fetal
Organ: skin
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4 kb resulted in an average insert size of 2.3 kb. This non-normalized primary library was constructed by Express Genomics (Frederick, MD) for the Bovine Genome Sequencing Program.


Name: GC_BGC-05
Library ID: 2305
Organism: Bos taurus
Strain: Hereford
Gender: male
Age: 7
Stage: adult
Organ: testis
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400 bp with average size 1.1 kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-13
Library ID: 2310
Organism: Bos taurus
Strain: Hereford
Gender: female
Age: 0
Stage: juvenile
Organ: thymus
Host: DH10B TonA
Vector: pCMV-SPORT6
Vector type: phagemid
Insert digest: 5' SalI/NotI 3'
Stop Codon Status: without
Description: Library is oligo-dT primed using 5'-GAGAGAGAGAAAGCGGCCGCAAGAGCTCTTTTTTTTTTTTTTTTVN-3'. Cap structure is biotinylated and Cap Trapper approach is used to select putative full-length cDNA. cDNA is subjected to oligo-dG tailing followed by second-strand synthesis using 5'-GAGAGAGAGAGAGATTGTCGACTTAATTAAATTAATCCCCCCCCCCCCC-3'. After restriction digest, cDNA is directionally cloned into pCMV-SPORT6 vector. Library is size selected >400bp with average size 1.5kb and is amplified once. Reference for library construction method: Methods in Enzymology 303:19-45. Sequencing primers: M13R (5') and M13F (3'). Library constructed in the laboratory of S. Moore (University of Alberta, Canada) for the Bovine Genome Sequencing Program.


Name: GC_BGC-16
Library ID: 2313
Organism: Bos taurus
Strain: L1 Hereford
Gender: female
Age: 0
Stage: adult
Organ: uterus
Host: DH10B TonA
Vector: pExpress-1
Vector type: plasmid
Insert digest: 5' EcoRV/NotI 3'
Stop Codon Status: without
Description: cDNA was primed using oligo-dT primer: 5'-pGACTAGTTCTAGATCGCGAGCGGCCGCCC(T)25-3' and cloned into the EcoRV/NotI sites of pExpress-1. Size-selection 1.4kb resulted in an average insert size of 2.4kb. This is a non-normalized library and was constructed by Express Genomics (Frederick, MD). Note: this is a Xenopus Gene Collection library.